ID: 1116158382

View in Genome Browser
Species Human (GRCh38)
Location 14:41236692-41236714
Sequence AGCTATCTGCAGAAGGTGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116158374_1116158382 25 Left 1116158374 14:41236644-41236666 CCACCAAAGCCCAGTAACAGGCC 0: 144
1: 161
2: 86
3: 68
4: 218
Right 1116158382 14:41236692-41236714 AGCTATCTGCAGAAGGTGACAGG No data
1116158377_1116158382 15 Left 1116158377 14:41236654-41236676 CCAGTAACAGGCCAAGAGCTGTC 0: 162
1: 189
2: 129
3: 114
4: 178
Right 1116158382 14:41236692-41236714 AGCTATCTGCAGAAGGTGACAGG No data
1116158376_1116158382 16 Left 1116158376 14:41236653-41236675 CCCAGTAACAGGCCAAGAGCTGT 0: 174
1: 194
2: 145
3: 123
4: 215
Right 1116158382 14:41236692-41236714 AGCTATCTGCAGAAGGTGACAGG No data
1116158375_1116158382 22 Left 1116158375 14:41236647-41236669 CCAAAGCCCAGTAACAGGCCAAG 0: 169
1: 171
2: 103
3: 76
4: 232
Right 1116158382 14:41236692-41236714 AGCTATCTGCAGAAGGTGACAGG No data
1116158380_1116158382 4 Left 1116158380 14:41236665-41236687 CCAAGAGCTGTCTCTCAAAGGGA No data
Right 1116158382 14:41236692-41236714 AGCTATCTGCAGAAGGTGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116158382 Original CRISPR AGCTATCTGCAGAAGGTGAC AGG Intergenic
No off target data available for this crispr