ID: 1116165479

View in Genome Browser
Species Human (GRCh38)
Location 14:41329607-41329629
Sequence CTGGGGGTCTGACTGTTAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116165479_1116165485 2 Left 1116165479 14:41329607-41329629 CCTTCTAACAGTCAGACCCCCAG No data
Right 1116165485 14:41329632-41329654 GCAAGTCTGTTGGAGTTTGCTGG 0: 66
1: 2154
2: 2130
3: 1177
4: 648
1116165479_1116165489 30 Left 1116165479 14:41329607-41329629 CCTTCTAACAGTCAGACCCCCAG No data
Right 1116165489 14:41329660-41329682 CACTCCAGACCCTGTTTGCTTGG 0: 60
1: 2983
2: 2381
3: 1144
4: 698
1116165479_1116165487 6 Left 1116165479 14:41329607-41329629 CCTTCTAACAGTCAGACCCCCAG No data
Right 1116165487 14:41329636-41329658 GTCTGTTGGAGTTTGCTGGAGGG 0: 8
1: 11
2: 13
3: 19
4: 192
1116165479_1116165480 -8 Left 1116165479 14:41329607-41329629 CCTTCTAACAGTCAGACCCCCAG No data
Right 1116165480 14:41329622-41329644 ACCCCCAGCTGCAAGTCTGTTGG No data
1116165479_1116165486 5 Left 1116165479 14:41329607-41329629 CCTTCTAACAGTCAGACCCCCAG No data
Right 1116165486 14:41329635-41329657 AGTCTGTTGGAGTTTGCTGGAGG 0: 79
1: 2063
2: 2962
3: 1473
4: 919

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116165479 Original CRISPR CTGGGGGTCTGACTGTTAGA AGG (reversed) Intergenic
No off target data available for this crispr