ID: 1116168597

View in Genome Browser
Species Human (GRCh38)
Location 14:41368107-41368129
Sequence AGTTGTGTACAGAGGATGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116168597_1116168601 6 Left 1116168597 14:41368107-41368129 CCTGTCATCCTCTGTACACAACT No data
Right 1116168601 14:41368136-41368158 CCATTCCTTGAATTCCTGCATGG No data
1116168597_1116168604 27 Left 1116168597 14:41368107-41368129 CCTGTCATCCTCTGTACACAACT No data
Right 1116168604 14:41368157-41368179 GGAAAGAGAGAAATTAGTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116168597 Original CRISPR AGTTGTGTACAGAGGATGAC AGG (reversed) Intergenic
No off target data available for this crispr