ID: 1116186835

View in Genome Browser
Species Human (GRCh38)
Location 14:41608482-41608504
Sequence GCCACCTGGAGCCACCTTGC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 267
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 244}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116186832_1116186835 -4 Left 1116186832 14:41608463-41608485 CCCGCGTACGACTGTGAAAGCCA 0: 1
1: 0
2: 0
3: 1
4: 26
Right 1116186835 14:41608482-41608504 GCCACCTGGAGCCACCTTGCCGG 0: 1
1: 0
2: 1
3: 21
4: 244
1116186833_1116186835 -5 Left 1116186833 14:41608464-41608486 CCGCGTACGACTGTGAAAGCCAC 0: 1
1: 0
2: 0
3: 2
4: 36
Right 1116186835 14:41608482-41608504 GCCACCTGGAGCCACCTTGCCGG 0: 1
1: 0
2: 1
3: 21
4: 244

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116186835 Original CRISPR GCCACCTGGAGCCACCTTGC CGG Exonic
900097372 1:945422-945444 GCCACCTGTACCCATCCTGCAGG - Intronic
900117441 1:1034591-1034613 GCCGCCTGGCGCCTCCCTGCTGG + Intronic
900313596 1:2046543-2046565 GCCACACAGAGCCACCTTGGCGG + Intergenic
900536942 1:3183370-3183392 GCCTGCTGGAGCCTCCGTGCAGG + Intronic
902384665 1:16069519-16069541 GCCTCCTGGCCCCACCTTGGGGG - Intronic
903217840 1:21852888-21852910 GCCCCCCGGGACCACCTTGCTGG - Intronic
905665774 1:39762095-39762117 GACACCTGGAGCCACCTCCTTGG - Intronic
907200964 1:52726574-52726596 GCCTCCTGGAGCCTCCGCGCCGG + Exonic
914922446 1:151856613-151856635 TCCTCCTGGGGCCACCTTGCTGG - Intergenic
916023772 1:160816466-160816488 GGCTCCTGGAGGCACTTTGCCGG + Intronic
917962311 1:180154809-180154831 GCCACGTGGCTCCTCCTTGCGGG + Intergenic
918194297 1:182207205-182207227 GCCCCCTTGCCCCACCTTGCTGG - Intergenic
918659691 1:187073764-187073786 TCCACCTGCAGCCCCCGTGCGGG - Intergenic
919297704 1:195722862-195722884 TCCACCTGCAGCCCCCGTGCTGG - Intergenic
921892711 1:220369104-220369126 GCCACGTGCAGCCACCTTCTAGG + Intergenic
921903760 1:220475616-220475638 TCCACCTGCAGCCCCCGTGCTGG - Intergenic
922797401 1:228347223-228347245 GCCTCCTGCATCCACCATGCTGG - Intronic
924412312 1:243819269-243819291 GCCAACTGGAGCTACAGTGCTGG - Intronic
1062920531 10:1275401-1275423 GCTGCCTGGAGCCGCCCTGCAGG - Intronic
1063033168 10:2256468-2256490 GCCACCTGGAGCAAAGCTGCAGG - Intergenic
1064028811 10:11870003-11870025 GCCCCCTGGGGCCCCCTCGCCGG - Exonic
1065645924 10:27833971-27833993 TCCACATGGCGCCACCTTACAGG + Intronic
1065773012 10:29095095-29095117 TCTATCTGGAGCCACCGTGCTGG - Intergenic
1066296169 10:34055927-34055949 TCCACCTGCAGCCCCCGTGCGGG + Intergenic
1067225099 10:44370800-44370822 GCCCTCTGGAGCCTCCTCGCTGG + Intronic
1070668284 10:78360709-78360731 GCCACCTGCACCCTCCTGGCTGG + Intergenic
1070746473 10:78936773-78936795 GCCAGCTGGAGCCAGCTGGAAGG - Intergenic
1070912904 10:80133500-80133522 TCCACCTGAGGCCACCTGGCAGG - Intronic
1073843091 10:107520645-107520667 GCCACTGGGAGCCTCCTTCCTGG + Intergenic
1074996272 10:118760095-118760117 TCCACCTGCAGCCCTCTTGCTGG - Intergenic
1075255698 10:120924237-120924259 TCCACCTGCAGCCCCTTTGCGGG + Intergenic
1075380210 10:122012767-122012789 GCCACCTGGAGCCCCCTCCATGG - Intronic
1075537446 10:123283302-123283324 TCCACCTGCAGCCCCTTTGCGGG - Intergenic
1075657856 10:124173852-124173874 GCCCCCTGGAGCCTCCCTCCAGG + Intergenic
1076329443 10:129653927-129653949 GCCAGGTGGAGCCACCTTTGGGG + Intronic
1076811055 10:132886560-132886582 CCCACCAGGATCCACCCTGCTGG - Intronic
1076932989 10:133546205-133546227 GCCACATGGAGCCACAGTGATGG - Intronic
1077182731 11:1223856-1223878 GCCACCGGGAGACACCCAGCCGG + Intronic
1077525289 11:3060561-3060583 GCCACCAGTGGCCACCGTGCAGG + Intergenic
1079555351 11:21753090-21753112 TCCACCTGCAGCCCCCGTGCGGG - Intergenic
1080606517 11:33869245-33869267 CGCACCTGGAGCCCCCTCGCGGG + Intronic
1081535560 11:43993620-43993642 GCCTCCTGGACGCCCCTTGCCGG + Intergenic
1081865465 11:46357367-46357389 GACACCTGGAGGCCCCTTTCTGG - Intronic
1082167573 11:48965842-48965864 GGAAACTGGAGCCACCTTGAGGG - Intergenic
1082235981 11:49820808-49820830 GGGAACTGGAGCCACCTTGAGGG + Intergenic
1082242708 11:49888988-49889010 GAGAACTGGAGCCACCTTGAGGG - Intergenic
1082609489 11:55280736-55280758 GGGAACTGGAGCCACCTTGAGGG + Intergenic
1082657200 11:55869797-55869819 GGGAACTGGAGCCACCTTGAGGG - Intergenic
1083581442 11:63827769-63827791 GCCACCTAGAGCAACCCTGAGGG + Intergenic
1083800908 11:65045781-65045803 CCCACCTGGAGGCACCTCCCAGG + Intronic
1083886734 11:65576714-65576736 GCCACCCTGAACCACCTTTCTGG - Intronic
1084316998 11:68351372-68351394 GACTCCTGGAGCCACAGTGCAGG - Intronic
1084383937 11:68830331-68830353 CCCACCTGGAGCCCACCTGCTGG + Intronic
1084872681 11:72108751-72108773 GCCAGCAGGTGCCACCGTGCTGG + Exonic
1087045718 11:93842439-93842461 ACCAACAAGAGCCACCTTGCTGG + Intronic
1087076772 11:94133137-94133159 TTCACCTGCAGCCACCATGCTGG - Intronic
1087894488 11:103572584-103572606 GCCCCATGGAGCATCCTTGCAGG + Intergenic
1090627367 11:128618643-128618665 GCCACCTGGCTCCACCTGGGAGG + Intergenic
1093034577 12:14320506-14320528 TCCACCTGCAGCCCCATTGCGGG + Intergenic
1094503242 12:31038570-31038592 GCCACCTGGAAGCTCCTTGGAGG - Intergenic
1094589227 12:31805737-31805759 TCCACCTGCAGCCACGGTGCGGG - Intergenic
1095776775 12:46018429-46018451 TCCACCTGCAGCCCCCGTGCGGG + Intergenic
1097019969 12:56013590-56013612 GCCAATTGGAGACACATTGCAGG - Intronic
1097251330 12:57633611-57633633 GCCGCTTGGTGCAACCTTGCAGG + Intergenic
1098829944 12:75350013-75350035 GCCAACTGGAGCCACAGTGGTGG - Intronic
1102740817 12:115205973-115205995 GCAAGCTGGAGCCACCCTACTGG + Intergenic
1102882257 12:116494518-116494540 GCCACCTGGATCCGCCTTCAAGG - Intergenic
1103475009 12:121211540-121211562 GCCACCTGGGGCCACTTTAAAGG + Intronic
1103947043 12:124532479-124532501 GCTCCCAGGAGCCCCCTTGCAGG - Intronic
1105252768 13:18715523-18715545 GCCACTTGGAGTCAGCTTGATGG + Intergenic
1105926249 13:25011450-25011472 GCTACCTGGTTCCACCTTTCTGG + Intergenic
1106038735 13:26069527-26069549 GCTACCTGGTTCCACCTTTCTGG - Intergenic
1106707773 13:32300245-32300267 GCCACCTGGTGCGAACTTCCAGG + Intergenic
1109492915 13:63126875-63126897 GCCAGCTGGAGACACCTGGCTGG - Intergenic
1111591103 13:90349011-90349033 TCCACCTGCAGCCCCCATGCGGG + Intergenic
1116186835 14:41608482-41608504 GCCACCTGGAGCCACCTTGCCGG + Exonic
1117512723 14:56470116-56470138 GCCAGCGTGAGCTACCTTGCTGG + Intergenic
1118476504 14:66122045-66122067 GCCTTCTGGAGCCATCTTGAGGG - Intergenic
1120258108 14:82145349-82145371 GCCACCTGGACCCACTTTTTTGG + Intergenic
1122439791 14:101722728-101722750 GCCACCTAGATCCCCCTTCCGGG - Intergenic
1125480218 15:40074721-40074743 TCCACCTGCAGCCCCATTGCGGG - Intergenic
1125579634 15:40776145-40776167 GCAATCTGGAGCTACCTTGGAGG + Intronic
1125688470 15:41578053-41578075 GCAGCCTGGAGCTACCTGGCAGG + Exonic
1126128157 15:45314510-45314532 TCCACCTGCAGCCCCCATGCGGG + Intergenic
1126678488 15:51182358-51182380 ACCACTGGGAGCCACCTTGGAGG + Intergenic
1127834045 15:62775751-62775773 GCCGCCCTGAGCCACCTTGTTGG - Intronic
1127865190 15:63026857-63026879 GGCACCTGGACCCTCCTAGCTGG + Intergenic
1128587930 15:68867370-68867392 GCCACCTTGAGCTACAGTGCTGG - Intronic
1129447814 15:75631166-75631188 GCCACCTGGAGACACCTTGTAGG + Intergenic
1129599380 15:76989395-76989417 GCCACCTGGAGGGACCCTACAGG + Intergenic
1129859241 15:78847286-78847308 TCCACCTGCAGCCCCCGTGCGGG + Intronic
1130251659 15:82303986-82304008 GTCCTCTGGAGCCACTTTGCTGG + Intergenic
1130411076 15:83649264-83649286 GCCACAGGGAGCCACCTTGGAGG + Intergenic
1131022620 15:89112143-89112165 GCCACCTGGAGAGAGCTTGCTGG + Intronic
1131846038 15:96491780-96491802 GCCACCTGCAGCCCCGGTGCGGG - Intergenic
1132319845 15:100918123-100918145 GCCACCTGGCGCCACCGCGAGGG - Intergenic
1132458155 16:35697-35719 GCCACCAGGAGCCTGGTTGCTGG + Intergenic
1132836743 16:1958148-1958170 TCCACCTGCAGCCCCCGTGCGGG - Intergenic
1133273662 16:4624360-4624382 GCCACCCGGAGCCCACTTGCAGG - Intronic
1133339437 16:5027160-5027182 GCCACCTGAAGCCACCCTGAGGG - Exonic
1133347655 16:5081215-5081237 GGCCCCTGGGGCCACCTGGCAGG - Intronic
1134014145 16:10877101-10877123 ACCGCTTGGGGCCACCTTGCAGG + Intergenic
1136505553 16:30700674-30700696 GCCACCGGGACCCGCCTTCCAGG - Exonic
1136512690 16:30748726-30748748 GCCCCCGGGAGCCGCCATGCGGG + Intronic
1137737182 16:50733592-50733614 GACTCCTGGAGCCACTTTGAGGG - Intergenic
1138138621 16:54546751-54546773 GGCTCCTGGAGCCTCTTTGCTGG - Intergenic
1138599687 16:58047122-58047144 GGCACCTGGGGTCACCCTGCCGG + Intergenic
1139901185 16:70329794-70329816 GCCACCTGGGGCCACCTACCAGG + Intronic
1139906034 16:70366587-70366609 GCCACCTGGGGCCATCTACCCGG + Intronic
1140722447 16:77784332-77784354 TCCACCTGCAGCCCCCATGCGGG - Intergenic
1142081744 16:88152981-88153003 GCCAGCCGGAGCCACGGTGCTGG - Intergenic
1142237886 16:88931212-88931234 GTCAACTGGGGCCAACTTGCAGG + Intronic
1143019250 17:3908156-3908178 GCCACCTGGAGCCCACAAGCCGG + Intronic
1146263281 17:31435482-31435504 GCCACCAGGAGGGACCTCGCTGG - Intronic
1146540293 17:33687616-33687638 GCCACCCAGAGCCACATTGAAGG - Intronic
1146941264 17:36845960-36845982 GCCACCTGGAGACACGGAGCAGG - Intergenic
1148347813 17:46915306-46915328 GCAACCTGAGGCCACCATGCTGG - Intergenic
1148688274 17:49512794-49512816 GACACCTGGCGGCACCTGGCGGG + Exonic
1148744204 17:49909471-49909493 CCACCCTGGAGCCCCCTTGCTGG + Intergenic
1148794858 17:50192063-50192085 CCCACCTGGGGCCACTCTGCTGG + Intronic
1151388557 17:73770481-73770503 GCCATCTGGCACCACCATGCAGG + Intergenic
1151605196 17:75131328-75131350 GCCCCCAGGAGCCTCCCTGCGGG - Intronic
1154128689 18:11716894-11716916 TCCACCTGCAGCCCCCGTGCGGG - Intronic
1154207040 18:12346282-12346304 GACACTTGGAGCCACCCTCCTGG - Intronic
1155114731 18:22752869-22752891 GCCACCTGAAGCAAAGTTGCTGG + Intergenic
1157464140 18:47930360-47930382 GGGACCTGGCGCCACCTTGCAGG - Exonic
1160890290 19:1374094-1374116 GACACCTGGACCCAGCCTGCTGG + Intronic
1161130861 19:2587717-2587739 GCCTCCAGGAGCTACCTGGCAGG + Intronic
1163528545 19:17835969-17835991 GCCACCTGGTGCCAGCCAGCTGG - Exonic
1166243102 19:41507439-41507461 TCCTCCTGGAACCACCTTTCTGG - Intergenic
1166918305 19:46211257-46211279 GTCAACAGAAGCCACCTTGCAGG + Intergenic
925191908 2:1892001-1892023 GGCAGGTGGAGCCACCTGGCGGG - Intronic
925292964 2:2760798-2760820 ACCACCTGGAGCAAGTTTGCTGG - Intergenic
925833381 2:7918245-7918267 GGCATCAGGAGCCACATTGCAGG + Intergenic
929271817 2:39981138-39981160 GCCATTTGCAGCCACCTTGAAGG - Intergenic
932138016 2:69247607-69247629 GCCACCTGCAGTGACATTGCTGG + Exonic
932359453 2:71092435-71092457 TCCACCTGCAGCCCCCATGCAGG - Intergenic
932413035 2:71558466-71558488 GGCACCATGAGTCACCTTGCAGG - Intronic
932773562 2:74514540-74514562 GGCCCCTGGAGCTTCCTTGCTGG - Exonic
933511397 2:83245914-83245936 TCCACCTGCAGCCCCCATGCGGG - Intergenic
934898293 2:98138040-98138062 GCCACATGGAGCCATGTTGGAGG - Intronic
935154193 2:100468036-100468058 CTCACCAGGAACCACCTTGCTGG - Intergenic
936025540 2:109028492-109028514 GCCACCATGAGCCACTGTGCAGG - Intergenic
938181949 2:129191841-129191863 GCTCCCTGTAGCCACCTGGCAGG + Intergenic
938266334 2:129930811-129930833 CCCACCTGTAGCCACCATCCAGG - Intergenic
938266748 2:129933490-129933512 ACCACCTGAGGCCACCTGGCAGG + Intergenic
941397858 2:164994702-164994724 TCCACCTGCAGCCCCCGTGCGGG - Intergenic
942867358 2:180691800-180691822 TCCACCTGCAGCCCCCGTGCAGG + Intergenic
947538143 2:230953912-230953934 GTCTCCTGGAACCACCTTCCTGG + Intronic
948125795 2:235563989-235564011 GCCTCCTGGAGCCTCTTTGTGGG + Intronic
948607783 2:239146948-239146970 GTCAGCTGCAGCCACCCTGCAGG - Intronic
948733314 2:239980891-239980913 GCCAGCTGGGGTCTCCTTGCTGG - Intronic
948854186 2:240722441-240722463 ACCAGCTGGACCCACCTTGACGG + Exonic
948906968 2:240984204-240984226 GCCAGGTGGAGGCACCCTGCTGG + Intronic
949027680 2:241774103-241774125 GGCACCTGGAGCTACCTTCCGGG + Intergenic
1169034238 20:2436543-2436565 GACACGTGGAGCCTCCCTGCGGG - Intergenic
1170611710 20:17919324-17919346 GGCTCATGGAGCCACCGTGCCGG - Intergenic
1170999378 20:21397225-21397247 GCCACCTGGGCCCTCCTCGCAGG - Exonic
1171464737 20:25319566-25319588 GCCACCTGGAGCTATCTTACAGG + Intronic
1172278538 20:33694424-33694446 GCCAGCTGGATCCACCAGGCAGG - Intergenic
1175936382 20:62516033-62516055 CCCACCTGTCCCCACCTTGCTGG + Intergenic
1176089785 20:63313682-63313704 GCCACCGGGTGCCTCCTTTCTGG + Intronic
1176207000 20:63894688-63894710 CCCACCCGGAGCCACCGTCCTGG - Intergenic
1176242709 20:64082528-64082550 GTCAGCTGGAGCCCCCTAGCAGG + Intronic
1176838281 21:13815410-13815432 GCCACTTGGAGTCAGCTTGATGG + Intergenic
1178664390 21:34533926-34533948 GCCACCCTGAGCCTCCTTGCTGG - Intronic
1179622352 21:42625602-42625624 GGCAGCTGGACCCACATTGCAGG + Intergenic
1181049723 22:20232768-20232790 GCCACAGGGAGCCACCTTCCAGG - Intergenic
1183057552 22:35316138-35316160 GCCTGCTGCAGCCACCCTGCCGG - Intronic
1183212943 22:36462129-36462151 TCCACCTTCAGCCAGCTTGCTGG - Intergenic
1183660128 22:39214958-39214980 GCCACCTGGAGTCACCGGGAAGG + Intergenic
1184749063 22:46473736-46473758 GCCACCAGGAGCCACCAAGCAGG - Intronic
1185179005 22:49348682-49348704 GCCCCCTGCAGCCACCATGCAGG + Intergenic
950887498 3:16374371-16374393 GCCACCTGCCGCCATCTTTCTGG - Intronic
952376227 3:32769916-32769938 GCCCCCTGAGGCCATCTTGCTGG + Exonic
953805536 3:46064654-46064676 GACACATGAAGCCACCATGCTGG + Intergenic
957002200 3:74899923-74899945 TCCACCTGCAGCCCCCATGCAGG - Intergenic
957419590 3:79951318-79951340 TCCACCTGCAGCCCCCATGCGGG - Intergenic
957631010 3:82715743-82715765 TCCACCTGCAGCCCCCATGCGGG + Intergenic
959117341 3:102193782-102193804 TCCACCTGGATCAACCTGGCTGG - Intronic
961514867 3:127426253-127426275 TGCTCCTGGAGCCACCCTGCTGG - Intergenic
964925325 3:161949415-161949437 GCAACTTGGAGTCATCTTGCTGG - Intergenic
965780563 3:172281483-172281505 TCCACCTGATTCCACCTTGCTGG - Intronic
967159437 3:186722504-186722526 GCCACCTGGAGTAATCTGGCAGG - Exonic
967254298 3:187574005-187574027 GCCACCTGGATCAGCCTTGGGGG + Intergenic
968290297 3:197533656-197533678 GGCTCCTGGAGACAGCTTGCTGG + Intronic
969867316 4:10084338-10084360 TGCAGCTGGAGCCACCTGGCTGG + Intronic
971812023 4:31439065-31439087 TCCACCTGCAGCCCCCGTGCGGG + Intergenic
972034729 4:34506567-34506589 TCCACCTGAAGCCCCCGTGCCGG - Intergenic
974641674 4:64640420-64640442 TCCACCTGCAGCCCCCATGCGGG - Intergenic
974919366 4:68219456-68219478 GCAACCTGGAGCCACCATCCTGG + Intergenic
975526180 4:75352920-75352942 CCCACCTGGGGACAACTTGCAGG - Intergenic
976209650 4:82654687-82654709 GCCACTGGGAGCCACCTACCTGG - Intronic
976406452 4:84665112-84665134 TCCACCTGCAGCCCCCGTGCAGG + Intergenic
976620019 4:87117909-87117931 GCCTGCTGGAGCAACCGTGCTGG - Intronic
979183096 4:117755146-117755168 GACACCTGAAGCCTCCCTGCAGG - Intergenic
980074761 4:128283610-128283632 GCCACCTGGGGCCACCATTTTGG + Intronic
983230590 4:165125887-165125909 TCCACCTGCAGCCGCCGTGCGGG - Intronic
985695590 5:1338365-1338387 GTCACCTGCAGCCACCTGGGAGG + Intronic
986094887 5:4544796-4544818 CCTATCTGGAGGCACCTTGCTGG + Intergenic
988086915 5:26485227-26485249 TCCACCTGCAGCCCCCATGCGGG - Intergenic
994171422 5:96662650-96662672 GCCACCTGCAGCCACCTGCCTGG - Intronic
994507188 5:100657176-100657198 TCCACCTGCAGCCCCCCTGCAGG + Intergenic
994509768 5:100688814-100688836 TCCACCTGCAGCCCCCGTGCGGG - Intergenic
995320013 5:110823817-110823839 GCCAGCTGGAGACACCCAGCTGG - Intergenic
995326348 5:110893974-110893996 TCCACCTGCAGCCCCCGTGCGGG - Intergenic
995485255 5:112633656-112633678 GCCAGCTGGAGACCCCTGGCTGG - Intergenic
997408788 5:133674093-133674115 GTGACCTGGAGCCCCCGTGCAGG - Intergenic
997519844 5:134515943-134515965 GCCATCTGTAGCCACCAGGCTGG + Intergenic
997598216 5:135121177-135121199 GCATCCTGGAGCCCCCTTGCGGG + Intronic
999039960 5:148398017-148398039 GCCACCTGGAGCCCTCCAGCTGG + Intronic
999307532 5:150529849-150529871 GCCACCAGGACCCTCCTTCCAGG - Intronic
999855210 5:155586699-155586721 TCCACCTGCAGCCCCCGTGCGGG - Intergenic
1000609207 5:163356227-163356249 TCCACCTGCAGCCCCCATGCAGG + Intergenic
1001531642 5:172466273-172466295 GCCACCTGGAAGCACATGGCCGG + Intergenic
1003647028 6:7921160-7921182 GCCACCTGGACCCACCTCTCTGG - Intronic
1003748085 6:9024680-9024702 TCCACCTGCAGCCCCCGTGCGGG + Intergenic
1004306052 6:14502780-14502802 GCCACGTGGGGCCACATTGGAGG - Intergenic
1004427358 6:15515398-15515420 GCCACCTGGTGCCACCTCACAGG - Intronic
1008651123 6:53564028-53564050 GCCACCAAAAGCCACCTCGCTGG + Intronic
1018446532 6:163863747-163863769 GCCACCTGCAGTCACAGTGCCGG + Intergenic
1018624574 6:165765233-165765255 TCCACCTGCAGCCCCCGTGCGGG - Intronic
1019587115 7:1811342-1811364 GGCTCCTGGCGCCTCCTTGCCGG + Intergenic
1019889275 7:3933005-3933027 GGCAGCTGGTGCCACCGTGCTGG + Intronic
1020016742 7:4835818-4835840 GCCACCTCGCCTCACCTTGCCGG - Intronic
1021816177 7:24449603-24449625 GCCACCTGGCTCCACCTCCCAGG + Intergenic
1022766551 7:33418676-33418698 GCATCTTGTAGCCACCTTGCTGG + Intronic
1025028667 7:55537975-55537997 GGCTCCTGGGGCCTCCTTGCTGG - Intronic
1029233916 7:99096183-99096205 GCCACCTGGAGCCTGGTTGGTGG - Intronic
1030301495 7:107978975-107978997 CCCTCCTGGACCCACCTTGGTGG + Intronic
1031992982 7:128209902-128209924 GCCACCTGCTGCCAGCATGCGGG + Intergenic
1032094297 7:128929905-128929927 CTCACCTGGAGCCACCTAGTTGG + Intergenic
1032328744 7:130957321-130957343 GCCACCCTGAGCCCTCTTGCTGG - Intergenic
1032508790 7:132455720-132455742 GCCACATGGAGCATCCTGGCAGG - Intronic
1034965728 7:155389456-155389478 TCCACCTGGGGCTGCCTTGCTGG - Intronic
1035068254 7:156123263-156123285 GCCACGTGGAGCGACCACGCAGG - Intergenic
1035309116 7:157953547-157953569 GCAACCTGGATCCACATGGCTGG + Intronic
1035548881 8:504502-504524 GCAAACTGGATCCACCCTGCAGG - Intronic
1036645538 8:10609639-10609661 GCCGCCCGGAGCCACCATGATGG - Exonic
1037962146 8:23105620-23105642 GCCATCTGCAGCCACCTGGATGG - Intronic
1037969306 8:23160788-23160810 GCCATCTGCAGCCACCTGGATGG + Intronic
1037983598 8:23272530-23272552 TCCACCTGCAGCCCCCGTGCGGG + Intronic
1038118154 8:24581394-24581416 GCCTCCAGGAGACATCTTGCAGG - Intergenic
1038398808 8:27267464-27267486 GTCAGCTGGAGTCACCATGCAGG - Intergenic
1046284984 8:112082966-112082988 TCCACCTGCAGCCCCCTTGCGGG - Intergenic
1048738306 8:137526348-137526370 GCTACCTGAAGCCACCATGCTGG - Intergenic
1048941650 8:139405368-139405390 GCCGCCTGGAGGCAACTGGCTGG - Intergenic
1049426003 8:142538169-142538191 GCCCCATGGTGCCACCTTTCTGG + Intronic
1049610198 8:143551571-143551593 GCCAGCTGGAGACACCCAGCCGG - Intergenic
1050456480 9:5839663-5839685 GCCCCCTGAAGCCCTCTTGCAGG + Intergenic
1051439925 9:17073016-17073038 TCCACCTGCAGCCCCCGTGCGGG + Intergenic
1055689252 9:78811655-78811677 GCCAGCTGGGGCCACCTTAGGGG - Intergenic
1055995883 9:82159473-82159495 TCCACATAGAGCCACCTTGGAGG - Intergenic
1056935472 9:90912448-90912470 GCCACCTGGGGCAACTCTGCTGG + Intergenic
1057302882 9:93896677-93896699 GGCACCTGGGCCCACCTTCCAGG - Intergenic
1057334435 9:94144679-94144701 AGAACCTGGAACCACCTTGCTGG - Intergenic
1059437952 9:114287747-114287769 GCCACCTGGGGCTACCATGGAGG + Intronic
1060551944 9:124489804-124489826 GCCACCTTAAGCCACCTCTCAGG - Intronic
1061934670 9:133850703-133850725 GTCACCTGGAGACACCTGCCAGG + Intronic
1062506616 9:136880797-136880819 GCCACCTGGAGCATCCTGGGTGG + Intronic
1062530280 9:136996634-136996656 GCCCCGTGGAGCCACCTAGGCGG + Exonic
1062537118 9:137025920-137025942 GCCACCTGGAGGCACCTGTGTGG - Intronic
1189179000 X:38985663-38985685 GCCCTGTGTAGCCACCTTGCAGG + Intergenic
1189905671 X:45756744-45756766 GGCAGCTGGAACCACCATGCTGG + Intergenic
1195443378 X:104922115-104922137 GCCCCCTCCAGCCACCTTGGTGG + Intronic
1198441919 X:136671788-136671810 GCCAGCTGGAGCTGCCTTGGAGG + Intronic
1198491711 X:137147625-137147647 GATACCTGTGGCCACCTTGCAGG - Intergenic