ID: 1116189237

View in Genome Browser
Species Human (GRCh38)
Location 14:41641985-41642007
Sequence CCATTGTCAGAAATAGAACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 335
Summary {0: 1, 1: 0, 2: 4, 3: 20, 4: 310}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116189237 Original CRISPR CCATTGTCAGAAATAGAACA TGG (reversed) Intronic
900508871 1:3047848-3047870 CCAATGTCAGAAATGAAAGAAGG + Intergenic
901775808 1:11559830-11559852 CCAGTGTCTGAAATGAAACATGG - Intergenic
903146028 1:21372499-21372521 CCACTGTCAGGGCTAGAACAGGG + Intergenic
906041589 1:42792164-42792186 CCAATATCAGAAATGAAACAAGG + Intronic
906307098 1:44726323-44726345 CCATTTGCACCAATAGAACAAGG + Intergenic
906324662 1:44837731-44837753 GTATTGCCAGAGATAGAACAAGG + Intronic
908000672 1:59675614-59675636 CCTTTCTCAAAAATAGCACATGG + Intronic
909597889 1:77427291-77427313 TTATTATCAGAAATAGAAGATGG + Intronic
909784916 1:79599410-79599432 TCATTGTCAGAAAAAGATAATGG + Intergenic
910175839 1:84429396-84429418 ACTTTGTCAGAAATATAATATGG - Intergenic
910198446 1:84671429-84671451 CCATGCACAGATATAGAACATGG + Intronic
910290945 1:85599868-85599890 CCATTTAAATAAATAGAACATGG + Intergenic
912186214 1:107279276-107279298 CCATTGTCAATAACAAAACAAGG - Intronic
912479802 1:109973916-109973938 TCATTTTCAGATATGGAACAAGG + Intergenic
912813018 1:112808100-112808122 CCTGTGTCAGCAATAGAATATGG + Intergenic
912882151 1:113425756-113425778 CCAATGTCAGGAATGAAACAGGG - Intronic
913312070 1:117510101-117510123 CTATTGTTAGATATAGAACTTGG + Intronic
919248637 1:195023407-195023429 CCAATGAAAGAAATAAAACAAGG + Intergenic
919567950 1:199212639-199212661 CCAATGTCAGAAATAGGAGGCGG + Intergenic
919929091 1:202209433-202209455 TCTTTGTGAGAAATAGAAAAGGG + Intronic
1063276614 10:4575595-4575617 CCAATATCAGAAATGAAACAGGG + Intergenic
1063356884 10:5409483-5409505 ACAGTGTAAGACATAGAACATGG + Intergenic
1063374123 10:5542587-5542609 CAAATATCAGAAATAAAACAAGG + Intergenic
1063422757 10:5926624-5926646 CCATTGGCAAACATAGACCATGG + Intronic
1064258357 10:13764838-13764860 CCATTCTCAGTAAAAGCACAGGG - Intronic
1065315755 10:24462390-24462412 CCATGGCCAGAAATCGAATAAGG + Intronic
1065930974 10:30478869-30478891 AGATGGTCAGCAATAGAACAAGG - Intergenic
1066671297 10:37843113-37843135 TCAGTGTCACATATAGAACAAGG + Intronic
1067276704 10:44841972-44841994 CTAATATCAGAAATAAAACAAGG + Intergenic
1067977922 10:51046975-51046997 AAAATGTCAGAAAAAGAACATGG - Intronic
1068323239 10:55448229-55448251 CAGTTGTCAGAAATCAAACATGG + Intronic
1068584812 10:58785378-58785400 CCATCTTCAGAAATAGAAATTGG + Intronic
1068909392 10:62362450-62362472 CCATTATCAGGAATAAAAAAGGG + Intergenic
1069101183 10:64322992-64323014 CCATTGTCAGCTAAAGAACCTGG - Intergenic
1069272690 10:66549368-66549390 TCAATATCAGAAATAGAAAAGGG - Intronic
1069340544 10:67403529-67403551 ACTTTGTCAGCCATAGAACATGG - Intronic
1069396379 10:67993895-67993917 CCATGGTCACAAATAATACAAGG - Intronic
1074315463 10:112357402-112357424 CAATTGTCTGAAATATCACAGGG + Intergenic
1074950580 10:118330610-118330632 AAATTGTCAGAAAGAGAAAAGGG - Intronic
1075699055 10:124456759-124456781 CCAGTGTCAGAAACACCACACGG - Intergenic
1076556964 10:131331241-131331263 CCAATGTCAGGAATAAAACATGG - Intergenic
1077715831 11:4579542-4579564 CGAATGCCAGAAATGGAACACGG + Intergenic
1079852332 11:25551461-25551483 GCATTGTAAGAATTAGAAAAGGG + Intergenic
1080026632 11:27621941-27621963 CCAATGTCACAAATAAAATAAGG - Intergenic
1080904697 11:36530168-36530190 CCAATGTCAGGAATGAAACAGGG - Intronic
1081157407 11:39711457-39711479 TCATTGTCACAAAGGGAACATGG - Intergenic
1081496591 11:43617356-43617378 CCAAAGTCAGAAGCAGAACAAGG - Intronic
1081612043 11:44568602-44568624 CCACTGCCAGAGATAGCACATGG - Intronic
1081889917 11:46532243-46532265 TGATTGTCAGAGATAGAACAGGG + Intronic
1082865462 11:57896182-57896204 CACTTGTAACAAATAGAACATGG + Intergenic
1083536683 11:63474893-63474915 CCATGGTCAAAAAAAGAACAAGG - Intronic
1084540755 11:69785287-69785309 CCATCAACAGAAATAGAAAATGG - Intergenic
1084606567 11:70175723-70175745 CCATTTTCTGGAACAGAACAGGG - Intronic
1086169983 11:83825515-83825537 CCATTGTCTGACATAGAATCCGG - Intronic
1087066203 11:94030224-94030246 CCATTGTCAGCTATAAAACTGGG + Intronic
1087329721 11:96765210-96765232 CCATTTACAGAAATAGTATACGG - Intergenic
1087704954 11:101479650-101479672 CCAATGTCAGAAACTGAACCAGG + Intronic
1088966014 11:114721873-114721895 CCATAGATAGAAATAGAACAGGG + Intergenic
1089896412 11:121934707-121934729 CCATTTTTAGAGATAGAAAATGG - Intergenic
1090282885 11:125472403-125472425 ACAATGTCAGGAATAGAAAAGGG + Intronic
1092896352 12:13014620-13014642 CCAATGTCAGAAATAAAAGAAGG - Intergenic
1093503958 12:19843259-19843281 GCACTGTCATAAATAGAACAGGG - Intergenic
1093515506 12:19981665-19981687 CGATTGTCAAAGACAGAACAAGG + Intergenic
1095289009 12:40453991-40454013 CCATTGTCAGTAAAAGAAATAGG - Intronic
1098726421 12:73973739-73973761 CTATTGTCAAAAATATAACCAGG - Intergenic
1099086028 12:78246925-78246947 CCATTGACAGAGAAAGAAGAGGG + Intergenic
1099618206 12:84966165-84966187 TCATTTTCAGCAAAAGAACACGG - Intergenic
1099909912 12:88817110-88817132 CCAATTTCAGGAATAAAACAGGG + Intergenic
1100001042 12:89835537-89835559 CCATTGTCAGAGCTTGAAGAAGG + Intergenic
1100158699 12:91832361-91832383 CCACAGCCAGAAATAAAACAGGG + Intergenic
1102429400 12:112870157-112870179 CCAGTATCTGGAATAGAACACGG - Intronic
1104454013 12:128895110-128895132 CCATTTCCAGAAGTAGGACAAGG - Intronic
1104577095 12:129977300-129977322 CCAATATCAGGAATAAAACAGGG + Intergenic
1104680230 12:130745632-130745654 CCAGTGTCAGCAAAAGAACCGGG - Intergenic
1104805011 12:131583978-131584000 CCACTATCAGGAATAAAACAGGG + Intergenic
1105648323 13:22345874-22345896 CCAAAATCAGAAATAGAAGAGGG + Intergenic
1105742001 13:23335948-23335970 TCATTGCCAGAAATAAAAGATGG + Exonic
1106455992 13:29927506-29927528 CCATTGTAAAAAAGAGAATAGGG + Intergenic
1107422948 13:40266619-40266641 CCATGGTCACAGATAGGACATGG - Intergenic
1109109829 13:58302648-58302670 CCATCATCATAAAAAGAACATGG - Intergenic
1109580457 13:64325187-64325209 CCATTACCAGAAATACAAGAGGG + Intergenic
1111660437 13:91203501-91203523 CTATTGTCACAAATAGTACCTGG - Intergenic
1113302758 13:109039970-109039992 CCAATATCAGTAATAAAACAAGG + Intronic
1113573480 13:111376717-111376739 CTAACGTCAGAAATAAAACAAGG - Intergenic
1114296226 14:21331616-21331638 CCACTGTCAGAAGTAGAGGAAGG - Intronic
1116105097 14:40492511-40492533 GCATTGTCAGAAATAGATGATGG - Intergenic
1116189237 14:41641985-41642007 CCATTGTCAGAAATAGAACATGG - Intronic
1117259152 14:54012181-54012203 CCATAATCAGGAATAAAACATGG - Intergenic
1117830295 14:59743503-59743525 GCATTGCCAGAAAGAGTACAAGG + Intronic
1117928948 14:60818276-60818298 TCATTGTGCAAAATAGAACAAGG + Intronic
1118537652 14:66786180-66786202 CCAATGTCATGAATAAAACAAGG + Intronic
1118573261 14:67215573-67215595 CAATAGTCAGAAATAGGAAAGGG + Intronic
1119549958 14:75501672-75501694 CCATAATCAGAAATAGAAATAGG - Intergenic
1120614076 14:86680405-86680427 CCAATATCAGAAATGAAACAAGG + Intergenic
1121219360 14:92274402-92274424 AGATTGTGAGAAAGAGAACAAGG + Intergenic
1121702717 14:95967808-95967830 AAATTGTAAAAAATAGAACAAGG - Intergenic
1121716019 14:96076272-96076294 CCAATATCAGAAATGGAAAAGGG - Intronic
1121976519 14:98409026-98409048 CCAGTGTCAAGAATAGAACTGGG + Intergenic
1123009968 14:105344610-105344632 CCATTATCAGAAGTAAAAGAAGG - Intronic
1123688190 15:22815273-22815295 CAATTGTCAGAATTGGAATATGG - Intronic
1124219890 15:27842021-27842043 CAATTATCAGAAATGAAACAAGG + Intronic
1124499014 15:30210198-30210220 CCAATGACAGAAATAATACATGG + Intergenic
1124744562 15:32328475-32328497 CCAATGACAGAAATAATACATGG - Intergenic
1124861654 15:33448003-33448025 CCAATGTAAGAGATAGAAAATGG + Intronic
1127500140 15:59547449-59547471 CCATTCTCAAAAATTGGACAGGG - Intergenic
1128232201 15:66043263-66043285 CCACTGTCAGAAATGTAGCAGGG + Intronic
1128409573 15:67380958-67380980 CCATTATAAGAAATAGGACTTGG + Intronic
1128952842 15:71905413-71905435 CCATTATCAGGAATAAAAAAAGG - Intronic
1130717918 15:86354442-86354464 CCATTGTCAGAAAAGGACCAGGG + Intronic
1130875258 15:88008280-88008302 GCATTGGTAGAAATAGAACCAGG - Intronic
1131022812 15:89113975-89113997 CCTTTGTTGGAAACAGAACAGGG - Intronic
1131772792 15:95758649-95758671 CCATGTCCAGAAATAGAACATGG - Intergenic
1132020749 15:98359985-98360007 CTAGTGTCAGGAATAAAACAAGG + Intergenic
1132088687 15:98929392-98929414 ATGGTGTCAGAAATAGAACACGG - Intronic
1134492862 16:14708925-14708947 CCATTTGCAGAATGAGAACAGGG - Intronic
1134498243 16:14748047-14748069 CCATTTGCAGAATGAGAACAGGG - Intronic
1134582331 16:15381044-15381066 CCATTTGCAGAATGAGAACAGGG + Intronic
1135313651 16:21425095-21425117 CCATTTGCAGAATGAGAACAGGG + Intronic
1135366575 16:21857375-21857397 CCATTTGCAGAATGAGAACAGGG + Exonic
1135445240 16:22513783-22513805 CCATTTGCAGAATGAGAACAGGG - Exonic
1136152789 16:28362819-28362841 CCATTTGCAGAATGAGAACAGGG + Exonic
1136193957 16:28638342-28638364 CCATTTGCAGAATGAGAACAGGG - Exonic
1136210294 16:28752454-28752476 CCATTTGCAGAATGAGAACAGGG - Exonic
1136310313 16:29403799-29403821 CCATTTGCAGAATGAGAACAGGG + Exonic
1136323762 16:29505589-29505611 CCATTTGCAGAATGAGAACAGGG + Exonic
1136438447 16:30245570-30245592 CCATTTGCAGAATGAGAACAGGG + Exonic
1137352495 16:47725890-47725912 CGAAGGTCAGAAATAGAACTAGG - Intergenic
1139857996 16:69996185-69996207 CCATTTGCAGAATGAGAACAGGG + Intergenic
1141485553 16:84337221-84337243 CCATTGTGAAAAATAGAGAAGGG + Intergenic
1141488767 16:84357784-84357806 GCATTTTCAGAAAAAAAACAGGG + Intergenic
1143071967 17:4303405-4303427 CTATTATAAGCAATAGAACATGG + Intronic
1144210887 17:13014438-13014460 CCATTGAAAGGAATAGAACTGGG - Exonic
1147264741 17:39227759-39227781 CCAGTGGCAGAAGTAGGACAAGG + Intergenic
1147336594 17:39730117-39730139 CCAATGTCAGAACTAGAAAGCGG + Intronic
1149729459 17:58930811-58930833 CCAATGTAAGATGTAGAACATGG + Intronic
1153370264 18:4307604-4307626 CCAGCCACAGAAATAGAACACGG + Intronic
1153847068 18:9059752-9059774 CCATTGACACAAAAAGCACACGG - Intergenic
1153936371 18:9928378-9928400 CCAGGGTTAGAAATAGAACTTGG + Intronic
1154165673 18:12012459-12012481 GCAGTGTCACAAATAGACCACGG - Intronic
1155566568 18:27141836-27141858 CCATTGGTAGAAATAGACTATGG - Intronic
1159884090 18:73887862-73887884 CCATTGGCAGAAATTGCCCAGGG + Intergenic
1166012229 19:39951102-39951124 CCAATGTCAGACATAAATCAAGG - Intergenic
1167848561 19:52184436-52184458 CCATTGGCAGGAGGAGAACAGGG - Intergenic
1168292866 19:55365581-55365603 CCTTTGTGAGACAGAGAACAGGG - Exonic
925210587 2:2042617-2042639 CCATTGGCAGAAATTTAAAAGGG + Intronic
926398825 2:12474298-12474320 CCAATATCAGAAATGGAAGAAGG - Intergenic
927086673 2:19679231-19679253 CCATTTTCAGAGAAAGAAAAAGG - Intergenic
928376286 2:30777298-30777320 CCATTGTCACATATATAAAATGG + Intronic
928785363 2:34878384-34878406 CTAATGTCAGAAACAGGACAAGG + Intergenic
928786665 2:34895253-34895275 CCATTATCAGTAATAAAAAATGG - Intergenic
929088149 2:38188991-38189013 CCATTGACAGAAATGGCAAACGG + Intergenic
929141729 2:38672423-38672445 CTATTTTCAGAAAGAGAAGAAGG + Intronic
929803857 2:45127712-45127734 CATTTGTCAGACATAGATCAAGG + Intergenic
929848072 2:45553937-45553959 CTATGGTCAGATATAAAACAAGG + Intronic
932709692 2:74053267-74053289 CCATTGTCAGAAACAGGACAAGG + Intronic
932925269 2:75965904-75965926 CCAGGTTCAGAATTAGAACATGG + Intergenic
933033112 2:77357328-77357350 GCATTGTGGGAAATAGAAAAAGG - Intronic
935588770 2:104825834-104825856 TTATTGTCTGAAATAGAACTTGG - Intergenic
937561236 2:123226600-123226622 CCATAGTCAGAAATTGAAGTTGG - Intergenic
937768546 2:125691083-125691105 CCAATATCAGAAATAAAACAGGG + Intergenic
937934022 2:127227874-127227896 CCCTTGTAACAAATAGAGCACGG + Intergenic
937944679 2:127322028-127322050 CCGTTGTAAGTAATAGAACTTGG - Exonic
939121774 2:138125858-138125880 CCATTCTCAGAAATAGCATTTGG + Intergenic
939432372 2:142128168-142128190 ACATTGTATTAAATAGAACAAGG - Intronic
939727496 2:145740972-145740994 CCATTCTCAGATACAGAAAAAGG + Intergenic
940119247 2:150244997-150245019 CCAATGCCAGAAATAAAACAGGG - Intergenic
943934610 2:193900240-193900262 CCATTGTTAGAAACAGAGTATGG - Intergenic
945589160 2:211707744-211707766 CCATTGCCAGAAATAGCAGTGGG - Intronic
945749347 2:213761549-213761571 ACAAAGTCAGAAATAGAAAAAGG + Intronic
946520785 2:220462237-220462259 CCATTGTCAGACATGTCACACGG + Intergenic
947710508 2:232311423-232311445 CCATGTCAAGAAATAGAACATGG + Intronic
947903861 2:233745383-233745405 CCAGTGTCAAAAAGAGAATAAGG - Intronic
947905263 2:233756741-233756763 CCAGTGTCAAAAAGAGAATAAGG - Intronic
1169187064 20:3627611-3627633 CCAATGTCAGAAATAAAAAAGGG + Intronic
1169747244 20:8954882-8954904 ACATTTTCTGATATAGAACAAGG + Intronic
1170162797 20:13332114-13332136 ACATTGTCAGAAATTGTCCATGG - Intergenic
1171432932 20:25096734-25096756 GCATTGGCTGAAATAGAACAAGG + Intergenic
1173133103 20:40412686-40412708 ACATTGGCACAAATAGAAAATGG + Intergenic
1174543027 20:51304531-51304553 CCACTGTCACAGATAGCACAAGG + Intergenic
1176766586 21:13024979-13025001 CCATTGTCAGTAAGTGAAGACGG - Intergenic
1177605187 21:23368717-23368739 AGAATGTCAGAAATAAAACAGGG + Intergenic
1177965726 21:27724598-27724620 ACATTGTCATCAAGAGAACAAGG - Intergenic
1182451016 22:30421661-30421683 CTTTTGTCAGAAATTGAAGAGGG + Intronic
1184677289 22:46050662-46050684 CCGTGGTCAGAGACAGAACAAGG - Exonic
1185124468 22:48999727-48999749 CCAATATCAGAAAGAGAAAATGG - Intergenic
949791321 3:7795556-7795578 ACATTTTCAGAAAAAGAAAAAGG - Intergenic
950009927 3:9715814-9715836 CCCCTGTCAGAAGTTGAACAGGG + Intronic
950319799 3:12040632-12040654 TCATTTTAAGAAACAGAACATGG - Intronic
951500165 3:23377133-23377155 CCATGGTCAGAAACAGAACACGG - Intronic
951780076 3:26353037-26353059 CCATTGCCAGAGAGAAAACAAGG + Intergenic
952993334 3:38852628-38852650 TCATTTCCAGTAATAGAACAAGG - Intronic
957556525 3:81769189-81769211 CCATTGTGTGGAATAGAAAAAGG - Intergenic
959720580 3:109482754-109482776 ACCTTGTCAGAGATAGGACAAGG - Intergenic
959796156 3:110430571-110430593 TCATTCTCAGAATTAAAACAAGG + Intergenic
960112549 3:113858931-113858953 CCAATATCAGGAATAAAACAGGG - Intronic
960743932 3:120865503-120865525 CCATTGGCAGAAATCAAGCAGGG - Intergenic
962361885 3:134749676-134749698 CCATAGTCAGAATAACAACAGGG + Intronic
963133509 3:141878966-141878988 CCTTTGCAAGAATTAGAACAAGG - Intronic
964291949 3:155191229-155191251 CCATTGTGTGAAGTAGAAAAAGG - Intergenic
964803133 3:160575937-160575959 CCATTAGCAGAAATAAAAAAAGG - Intergenic
965533273 3:169798266-169798288 CTATTGTCAGAAATAGTAAAGGG + Intronic
965682616 3:171267057-171267079 GCATCCTAAGAAATAGAACATGG - Intronic
965912287 3:173793792-173793814 TCATTCTCAGAAATATGACAGGG - Intronic
966585559 3:181620334-181620356 CCATTTTCAGAAATATTATAAGG - Intergenic
966902675 3:184498332-184498354 CAATTGACAGGAAAAGAACACGG - Intronic
967284751 3:187858253-187858275 CCATCCTCAGAAATAGACCCCGG + Intergenic
968311259 3:197685097-197685119 CCTTTGTCAGAAATAGGCTATGG - Intronic
969170198 4:5356101-5356123 GCAATGTGAGAAATAGATCAGGG + Intronic
971235505 4:24838282-24838304 CCATTGGTAGAAAAAGAAAAAGG + Intronic
971238243 4:24863342-24863364 CCAGTGTCTGGAATAGCACACGG - Intronic
972852519 4:43068647-43068669 CCAATGATAGAAATAGAGCAGGG + Intergenic
974458472 4:62159169-62159191 CTGTTGTGAGAAATAGAAAATGG + Intergenic
974692808 4:65321390-65321412 CAAGTGTGAGAAATGGAACAAGG - Exonic
974862276 4:67537062-67537084 CCAATGTCAGGAATAAAAAAGGG + Intronic
977355040 4:95935114-95935136 CCAATATCAGAAATAAAAGAAGG + Intergenic
977426838 4:96877016-96877038 CCAATGTTAGAAGTAGAACCTGG - Intergenic
978589263 4:110306720-110306742 GCATTGTCATAAATGGAAAAGGG - Intergenic
978938372 4:114407057-114407079 TAATTGTCAGAAATTGAACTGGG - Intergenic
978978589 4:114913088-114913110 CCATTGTCAAAAATTGGATATGG - Intronic
981187608 4:141822366-141822388 ACATTAACAGAAGTAGAACAAGG + Intergenic
983009945 4:162535582-162535604 CCAGTGTCAGAAATTTAAAAAGG + Intergenic
984357938 4:178688946-178688968 CCAATATCAGAAATTAAACAAGG - Intergenic
984860967 4:184237893-184237915 ATATTCTCAGAAATCGAACATGG + Intergenic
984998146 4:185456543-185456565 CCAATGTCAGAAATTAAAGAGGG + Intronic
987732337 5:21790915-21790937 CCATTGTGTGAAATAGAGCCTGG - Intronic
987956151 5:24743205-24743227 TCTTTGAAAGAAATAGAACATGG - Intergenic
988371631 5:30376930-30376952 GCATTCTAAGAAATAGTACATGG + Intergenic
988885800 5:35556620-35556642 CCATTGTCAGAAAAAATGCATGG - Intergenic
989309069 5:39992398-39992420 CCATTGACATAAATAAAAGATGG - Intergenic
991193300 5:63901482-63901504 CCAATGTCAGGAATATGACAAGG + Intergenic
991399528 5:66238472-66238494 CCATTGTCACAACCAGCACATGG + Intergenic
994281163 5:97903457-97903479 CCATTGTCAGAAATGAAAGAGGG - Intergenic
996270114 5:121594588-121594610 CCATTTACTGAAATAGAACTTGG - Intergenic
996975525 5:129429043-129429065 CAAAGATCAGAAATAGAACATGG - Intergenic
997314537 5:132921403-132921425 CCATTGGCAGGAATAAAAAATGG + Intronic
998188051 5:139998041-139998063 CCAAAGTGAGAGATAGAACAAGG + Intronic
1000273790 5:159713502-159713524 ACTTTGTCAGAAAAAGAGCAGGG + Intergenic
1000877459 5:166658611-166658633 CCATATTTAGAAATAGACCAAGG - Intergenic
1002708962 5:181182668-181182690 TTATAATCAGAAATAGAACAGGG - Intergenic
1003088602 6:3082014-3082036 CCATTGTCGTAAAGGGAACAAGG + Intronic
1003486920 6:6588052-6588074 CCAAACCCAGAAATAGAACACGG + Intergenic
1003497404 6:6676378-6676400 ACATTGACAGAAATAGAAACAGG - Intergenic
1004757987 6:18633970-18633992 CCATTCACATGAATAGAACAAGG + Intergenic
1004827654 6:19440875-19440897 GCATGGTCATAAGTAGAACAGGG + Intergenic
1004989798 6:21124633-21124655 CCATTGCCACAAAGAGAACGAGG - Intronic
1005410583 6:25541336-25541358 ACATTGTACCAAATAGAACAAGG - Intronic
1009587434 6:65625140-65625162 CAATTGTCAGAAGGAAAACAGGG + Intronic
1009988696 6:70814045-70814067 TCATTTTTAAAAATAGAACATGG - Intronic
1010225136 6:73481871-73481893 CCATATTCAGAAATAGAATATGG - Intronic
1010912481 6:81576472-81576494 ACTTTGTAAGAATTAGAACATGG - Intronic
1012420503 6:99059317-99059339 CCCTTCTCAATAATAGAACAAGG - Intergenic
1012966370 6:105678319-105678341 CTATTTTGAGAGATAGAACAAGG - Intergenic
1014327081 6:120011621-120011643 CCAACATCAGAAATACAACAGGG - Intergenic
1015604186 6:134938388-134938410 CTATTAGCAGAAAAAGAACAAGG + Intronic
1015849314 6:137555199-137555221 CCATAGTCACCAAAAGAACATGG - Intergenic
1016152506 6:140760221-140760243 CCAGTGTCAGAAATAAAACATGG + Intergenic
1016369728 6:143361177-143361199 CCAATATCAGAAATAAAAGAGGG + Intergenic
1017408408 6:154143966-154143988 CCAATATCAGAAATGAAACAGGG + Intronic
1017609197 6:156166604-156166626 ACATTTTCAGAAAAATAACATGG + Intergenic
1017610681 6:156183184-156183206 TCATGGTCAGAAATGGAAAAGGG - Intergenic
1018032722 6:159855237-159855259 TCATTGTCAAAAACAGAAAAAGG - Intergenic
1018456046 6:163953236-163953258 CAATTGTCACAAATGAAACATGG - Intergenic
1019315563 7:383066-383088 CCAATGTCAGAGATAAAACAGGG + Intergenic
1019874256 7:3794752-3794774 CCAATTTCAGAAACAGAAAATGG + Intronic
1020859548 7:13473905-13473927 CCAGCGTCAGAAATAAGACAAGG + Intergenic
1021045397 7:15916795-15916817 CTATTGTAAGATGTAGAACATGG + Intergenic
1021281175 7:18719850-18719872 ACTTTGTAACAAATAGAACAGGG - Intronic
1021282595 7:18739291-18739313 CCCTTGCCAGCAATGGAACAAGG - Intronic
1021750180 7:23790491-23790513 GAATTTTCAGAATTAGAACATGG + Intronic
1022592495 7:31678992-31679014 GCATTGGCAGAAATAAAGCATGG + Intergenic
1022885763 7:34642061-34642083 CCAATGGCAGAAATATGACAGGG + Intergenic
1024172017 7:46798915-46798937 CCAATGTCAGAAATAAGAGAAGG - Intergenic
1024910896 7:54445578-54445600 CAATGGTCAGAACAAGAACAGGG + Intergenic
1025859123 7:65310015-65310037 CCATTCTCTTTAATAGAACAAGG + Intergenic
1026095533 7:67343523-67343545 GCATTGGCAGTAATAGGACATGG + Intergenic
1026626758 7:72000320-72000342 CCAATATCAGAAATGAAACAGGG + Intronic
1028249182 7:88520598-88520620 CCATTGTCAATAAAAGAAAATGG - Intergenic
1028370050 7:90081503-90081525 CCAGTGTCAGAATTTGAAGATGG - Intergenic
1028399688 7:90411438-90411460 CCATATACAGAAAAAGAACATGG + Intronic
1028898343 7:96067035-96067057 CCGTTAGCAGAAATAAAACACGG - Intronic
1030785135 7:113650877-113650899 CTATTTTCAGAAATAATACAAGG + Intergenic
1033777076 7:144623783-144623805 CCCTTGTGAGACACAGAACAAGG + Intronic
1035896608 8:3409593-3409615 CCATTTTCAGAAATTGAAAAGGG - Exonic
1036697668 8:10988611-10988633 CCCTTGTCAGCAGTAGATCATGG - Intronic
1037581420 8:20247934-20247956 CTACAGTCAAAAATAGAACATGG + Exonic
1037593925 8:20338010-20338032 CCAATGTCAGAAATGAAAGAAGG + Intergenic
1040732580 8:50467485-50467507 CCAGTGTCAGAAATGAAAGAGGG - Intronic
1040848940 8:51878382-51878404 AAATTGTGAGAAATAGCACAAGG - Intronic
1042054502 8:64749668-64749690 CCATTATAAGAACTATAACAAGG - Intronic
1042074577 8:64977762-64977784 ATATTTACAGAAATAGAACACGG + Intergenic
1042081963 8:65063888-65063910 CCAATGTTAGAAACAAAACATGG + Intergenic
1043044150 8:75300027-75300049 CCATTTTGAGAAATGGAAGATGG + Intergenic
1043095934 8:75972233-75972255 CCATTGTCAGAAATGGTGCTAGG - Intergenic
1043445031 8:80311020-80311042 CCATTTTAAGATAAAGAACAAGG - Intergenic
1046537964 8:115540451-115540473 CCATTCTCAGAAAAATAAAAAGG + Intronic
1047244402 8:123127081-123127103 CCAGTGTCTGACATATAACAGGG - Intronic
1047861503 8:128972226-128972248 CTATTGTAAGAAATAGGATAAGG + Intergenic
1047927954 8:129699584-129699606 TCAGAGTCAGAAATAGAAGAAGG + Intergenic
1053708524 9:40781229-40781251 CCATTGTCAGTAAGTGAAGACGG + Intergenic
1054418435 9:64902024-64902046 CCATTGTCAGTAAGTGAAGACGG + Intergenic
1057531675 9:95852951-95852973 ACATTGTGAGAGATAGAACTTGG - Intergenic
1057760783 9:97872815-97872837 GCATTGTAAGAAATAATACATGG - Intergenic
1057928467 9:99172803-99172825 ACCTTGTCTGAAATGGAACAGGG + Intergenic
1058803878 9:108570890-108570912 TCAATGTCAGAAATAGGACAAGG + Intergenic
1058812468 9:108654398-108654420 CTACTGTCAGAAATACAACTGGG + Intergenic
1186009139 X:5109236-5109258 CCATTATAAGCAATAGAAAATGG + Intergenic
1186812339 X:13202553-13202575 CCAATGTCAGAACTATATCAAGG - Intergenic
1187528563 X:20075864-20075886 CTCTTGTCAGAGATAGAAAATGG - Intronic
1187695802 X:21918617-21918639 CCATTGTCACCAAAAGAGCATGG - Intergenic
1187723010 X:22171467-22171489 TCACTGTCAGAAAAAGAAAAGGG - Intronic
1187723111 X:22172563-22172585 TTATTGTCAGAAAAAGAAAAGGG + Intronic
1187909618 X:24098966-24098988 CCAATATCAGGAATGGAACAGGG - Intergenic
1188179883 X:27041290-27041312 CCAATATCAGAAATAGAAACAGG - Intergenic
1189617864 X:42802530-42802552 ACGTTGTCAAAAAAAGAACAAGG - Intergenic
1189949897 X:46218097-46218119 CCTTTGTCAAAATTAGAAGAAGG + Intergenic
1190226547 X:48550444-48550466 CCACTGTCATAAAAATAACATGG - Intronic
1190655003 X:52603702-52603724 CCATGATGAGAAACAGAACATGG + Intergenic
1192548590 X:72034763-72034785 CCAATGTCAGGAATGAAACAGGG - Intergenic
1193348708 X:80432675-80432697 TCATTGTCTGAGATAGAACATGG + Intronic
1193423394 X:81311777-81311799 CCATAGTCACAAAAACAACATGG - Intergenic
1193843316 X:86436992-86437014 CTAATGTCAGAAATAAAAGAGGG - Intronic
1194346088 X:92768351-92768373 TCAGTGTCAGAAATGTAACAAGG + Intergenic
1194479581 X:94404235-94404257 CCAAATTAAGAAATAGAACATGG - Intergenic
1195362846 X:104101635-104101657 CCATTGTCAGAGATAAAACACGG + Exonic
1197119935 X:122879045-122879067 ACATTGTCAAAAATATAAAATGG + Intergenic
1197785045 X:130190577-130190599 CCATTGTATGAACAAGAACATGG + Intergenic
1198220396 X:134594703-134594725 CCAGCATCAGAAACAGAACAGGG - Intronic
1198447665 X:136734294-136734316 CCACTATCAGAAATGAAACAGGG + Intronic
1198661327 X:138971116-138971138 CCCTGGTGAGAAATAGGACAGGG + Intronic
1199038600 X:143082867-143082889 CCAAATTCAGAAATAGATCATGG + Intergenic
1199572327 X:149279453-149279475 CCATGGAGAGAAATAAAACAGGG + Intergenic
1200654431 Y:5885000-5885022 TCAGTGTCAGAAATGTAACAAGG + Intergenic
1200705544 Y:6439459-6439481 CCATTGGCTGAAAAGGAACATGG + Intergenic
1201028567 Y:9725249-9725271 CCATTGGCTGAAAAGGAACATGG - Intergenic
1201350299 Y:13032999-13033021 CCAAGATCAGAAAGAGAACAAGG + Intergenic