ID: 1116190588

View in Genome Browser
Species Human (GRCh38)
Location 14:41660311-41660333
Sequence AGTCATATGGCTGGGTGTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3894
Summary {0: 1, 1: 3, 2: 73, 3: 585, 4: 3232}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116190588_1116190593 27 Left 1116190588 14:41660311-41660333 CCACCACACCCAGCCATATGACT 0: 1
1: 3
2: 73
3: 585
4: 3232
Right 1116190593 14:41660361-41660383 ATTTCAACCCCAAACCCTGCTGG 0: 1
1: 0
2: 3
3: 14
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116190588 Original CRISPR AGTCATATGGCTGGGTGTGG TGG (reversed) Intronic
Too many off-targets to display for this crispr