ID: 1116193649

View in Genome Browser
Species Human (GRCh38)
Location 14:41692557-41692579
Sequence GTGGTGTGGGGGAAGTTAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2288
Summary {0: 1, 1: 0, 2: 7, 3: 152, 4: 2128}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116193649_1116193660 19 Left 1116193649 14:41692557-41692579 CCTCCTAACTTCCCCCACACCAC 0: 1
1: 0
2: 7
3: 152
4: 2128
Right 1116193660 14:41692599-41692621 TGTTCCCCTTCCTGTGTCCAAGG 0: 82
1: 84
2: 107
3: 87
4: 402
1116193649_1116193661 20 Left 1116193649 14:41692557-41692579 CCTCCTAACTTCCCCCACACCAC 0: 1
1: 0
2: 7
3: 152
4: 2128
Right 1116193661 14:41692600-41692622 GTTCCCCTTCCTGTGTCCAAGGG 0: 27
1: 68
2: 83
3: 92
4: 251

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116193649 Original CRISPR GTGGTGTGGGGGAAGTTAGG AGG (reversed) Intronic
Too many off-targets to display for this crispr