ID: 1116194617

View in Genome Browser
Species Human (GRCh38)
Location 14:41707183-41707205
Sequence TTTTATCTTACTAAGGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 199
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 188}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116194613_1116194617 -7 Left 1116194613 14:41707167-41707189 CCTGCCTTAAATGCAATTTTATC 0: 1
1: 0
2: 0
3: 30
4: 322
Right 1116194617 14:41707183-41707205 TTTTATCTTACTAAGGTGGAAGG 0: 1
1: 0
2: 1
3: 9
4: 188

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116194617 Original CRISPR TTTTATCTTACTAAGGTGGA AGG Intronic
906829151 1:49013477-49013499 CTTTATTTTACAAAGTTGGAAGG + Intronic
907521209 1:55024424-55024446 TTTACTCTTAAAAAGGTGGATGG + Intergenic
910043934 1:82888952-82888974 TTTTATCTAACTTTGATGGAAGG + Intergenic
910249145 1:85176364-85176386 TTTTATCTTACTAAAATGCTTGG + Intronic
911960211 1:104292163-104292185 TTTTCTCTAAGTGAGGTGGAAGG + Intergenic
912022538 1:105123150-105123172 TATTATCTTTATATGGTGGAAGG + Intergenic
912063123 1:105698935-105698957 ATTAATTTTATTAAGGTGGAAGG + Intergenic
912158117 1:106947359-106947381 TCTTATCTTAATAAGATAGAAGG + Intergenic
912587029 1:110776414-110776436 TTGAAGCTTACTAAAGTGGAAGG - Intergenic
912986028 1:114431813-114431835 CCTTATCTTACTAAGGTGAGTGG + Intronic
913267819 1:117061912-117061934 TTTTTTCATAATAAGTTGGAAGG + Intronic
914923837 1:151866408-151866430 TTTTATCTTTGTAACGTGGCTGG + Intergenic
917195343 1:172458250-172458272 TTCTTTCTTTCTAATGTGGATGG - Intronic
917562828 1:176177756-176177778 TTGTATTTTGTTAAGGTGGAGGG - Intronic
919344821 1:196361982-196362004 TTTTATCCACCTAAGGAGGAGGG + Intronic
919479926 1:198075622-198075644 TTTTATCTTGATAAGAAGGAAGG - Intergenic
919973347 1:202594874-202594896 TTTTATTTTAAAAAGGGGGAAGG - Exonic
920783320 1:209015576-209015598 TTTTTACTTGCTAAGGTTGAGGG + Intergenic
921175925 1:212594533-212594555 TTTTGCCTTATTAGGGTGGAAGG + Intronic
922333812 1:224602059-224602081 GTTGATCTTATGAAGGTGGAAGG - Intronic
922403305 1:225284079-225284101 TGGTATTTTCCTAAGGTGGAAGG - Intronic
922823595 1:228501837-228501859 TTTCAACGTACTAATGTGGAGGG - Intergenic
1064943507 10:20761309-20761331 CTTTATCTTACTCTGGAGGAAGG + Intergenic
1066535692 10:36388881-36388903 TTTTTTTTAACTAAGCTGGAAGG + Intergenic
1066643356 10:37579281-37579303 TTTTTTTTAACTAAGCTGGAAGG + Intergenic
1068244691 10:54349258-54349280 TTTTATCTCCCTAAGTTGTAGGG - Intronic
1069041231 10:63697599-63697621 TTTTGTATTTCTAAGATGGAAGG + Intergenic
1069354514 10:67568274-67568296 TTTTCTCTGACTAATATGGATGG - Intronic
1069357527 10:67604499-67604521 TTTGATTTTACTATGGAGGAAGG + Intronic
1069878482 10:71577503-71577525 GTTATTCTTATTAAGGTGGAGGG + Intronic
1072556225 10:96515787-96515809 TTTTATGTTATTAAAGTAGAAGG + Intergenic
1074695140 10:116043799-116043821 TTTTATCTGACTAAATTGCATGG + Intergenic
1075593328 10:123708590-123708612 TTTTACTTTACTCAGGTGAATGG - Intronic
1076298305 10:129404418-129404440 TTGTATCATTCTAAGGTGAAGGG - Intergenic
1076399748 10:130174210-130174232 ATGTCTCTTGCTAAGGTGGAGGG + Intronic
1078491046 11:11769172-11769194 TTTCTGCTTACAAAGGTGGAGGG - Intergenic
1078635974 11:13050590-13050612 TATTTTCTTCCTAGGGTGGAAGG + Intergenic
1079626617 11:22624838-22624860 CTTTATCTTTCAGAGGTGGAGGG + Exonic
1080184782 11:29469231-29469253 ATCTATCTTAATAAGGTGGCTGG + Intergenic
1089056609 11:115590742-115590764 TTTTCTCTTAGGAAGGTGAATGG + Intergenic
1092677554 12:10938832-10938854 TTTTCTCTACCTAAAGTGGAGGG - Exonic
1093029729 12:14277088-14277110 TTCTCTCTTACTAAGGTTGCAGG + Intergenic
1093591470 12:20907035-20907057 TTTTTACTTACTAATATGGAAGG + Intronic
1093827023 12:23705453-23705475 CTTTATCTTTCTAATGTTGAGGG + Intronic
1094221537 12:27998873-27998895 TTTTCTCTTCCTTAGGGGGAGGG + Intergenic
1095369123 12:41444995-41445017 TTTGATCTTTCTATGATGGAAGG - Intronic
1096645434 12:53031625-53031647 TTTTATCTTACAAAAGTGACGGG + Intronic
1097589645 12:61558530-61558552 CTTTCTCTTACCAAGCTGGAGGG - Intergenic
1097828977 12:64203860-64203882 TTTTAGCTTCCTCAGCTGGAAGG - Intronic
1098113423 12:67148478-67148500 TTTTAACTTTCTAAAGTGGTTGG + Intergenic
1099792604 12:87355793-87355815 TTTTATCTTTCTTAGGAGGTGGG + Intergenic
1107982424 13:45746283-45746305 TTTTTTCTTCCTTAAGTGGAAGG - Intergenic
1110172922 13:72524001-72524023 TTTTACCCTCCTAAGTTGGACGG + Intergenic
1110271604 13:73597411-73597433 TTTTTTTTAACTAAGATGGATGG + Intergenic
1110345128 13:74438209-74438231 AGTTTTGTTACTAAGGTGGATGG + Intergenic
1113730826 13:112640247-112640269 TTTTATTTTGATAATGTGGATGG - Intergenic
1116194617 14:41707183-41707205 TTTTATCTTACTAAGGTGGAAGG + Intronic
1116306253 14:43261128-43261150 TTTTATCCTACTAAGGGCCAAGG + Intergenic
1119493251 14:75055939-75055961 TTTTATCTTTGTAAGGTTGGTGG - Intronic
1119986413 14:79143103-79143125 TTTTATCTTACTTAACTGTAAGG + Intronic
1120618203 14:86733133-86733155 TTTCCTCTTAAAAAGGTGGATGG + Intergenic
1123819375 15:24012341-24012363 TTTATTCTTACTTTGGTGGAAGG + Intergenic
1123929171 15:25151458-25151480 CTGTATTTTTCTAAGGTGGAAGG - Intergenic
1124405136 15:29385281-29385303 TTTTATCTTATTAAGCTACAGGG + Intronic
1125148777 15:36506529-36506551 TATTATTCCACTAAGGTGGATGG - Intergenic
1125220992 15:37335036-37335058 TTTTCTCATAGTAAGGTGCATGG + Intergenic
1125596911 15:40893348-40893370 TTCTACCTTGCTAAAGTGGAAGG - Intergenic
1127185063 15:56470348-56470370 ATGTATCTTACTAAGGGTGAAGG + Intergenic
1130154881 15:81341673-81341695 TCTTATCTTTAGAAGGTGGAGGG - Intronic
1132340358 15:101074361-101074383 TTTTCTCTTAAAAAGGTGGCTGG + Intronic
1134198859 16:12181217-12181239 GTTTATTTTGCTAAGGTTGAGGG + Intronic
1137714998 16:50593137-50593159 TTTAATTTCACTAAGGAGGATGG - Intronic
1137764969 16:50971003-50971025 TTTTATCTTTCTAAAGTGGTGGG - Intergenic
1138839342 16:60480187-60480209 TATTATTTTACTTAGTTGGATGG - Intergenic
1141469804 16:84230618-84230640 CAGTGTCTTACTAAGGTGGAGGG - Intronic
1146925878 17:36744728-36744750 TTTTTTTTTAGTAAGGTGGAAGG - Intergenic
1149278430 17:55072048-55072070 TTTCCTCTTCCTAAGGTGGAAGG + Intronic
1149579009 17:57734976-57734998 TTTTTTCTTTCTGGGGTGGAGGG - Intergenic
1149697401 17:58626907-58626929 TTTTATCTGATCAAGGTGAAGGG - Intronic
1152771506 17:82172414-82172436 TTTTATATTTGTAAAGTGGAAGG - Intronic
1153553934 18:6290888-6290910 TTTTATATTAGAAAGTTGGATGG - Intronic
1156145990 18:34179282-34179304 TTCTAGTTTATTAAGGTGGAAGG - Intronic
1162930254 19:13953949-13953971 ATTTATCCTACTAAGGAGGCTGG - Intronic
1164459281 19:28433774-28433796 TTTACTCTTAAAAAGGTGGATGG - Intergenic
1164505454 19:28856989-28857011 TATTATCTTTATAAGGTGGACGG - Intergenic
1164952649 19:32351053-32351075 TTTCATCTTTCTCAGGTAGAAGG - Intronic
926450958 2:13003184-13003206 TTTTATCTCATTAAGCTAGATGG + Intergenic
928860741 2:35854621-35854643 TGTCATCTTACTAAGGATGAAGG - Intergenic
929255037 2:39801532-39801554 TTTTATCTTTCTGAGGTGGCTGG + Intergenic
930321635 2:49862098-49862120 TTTTTCCTTAATAAGGTGAAGGG - Intergenic
930454308 2:51585455-51585477 TTTTATTTGACGAAGGTGGTAGG + Intergenic
931789767 2:65654491-65654513 TTTTGCCTTGCTAAGGAGGAGGG - Intergenic
938316811 2:130335306-130335328 ATTTATCTGACTAAGGAGGGAGG + Intergenic
938794998 2:134710627-134710649 TTTTTTTTTAGTTAGGTGGAAGG - Intronic
941029496 2:160494105-160494127 TTTTATCTTCGTAAGGGGGAGGG + Intergenic
941078562 2:161033936-161033958 TTTTATCTTAGGGAGGTTGATGG - Intergenic
942930713 2:181489080-181489102 TTTTATTTTTCTGGGGTGGATGG + Intronic
944879515 2:203997785-203997807 TTGGATTTTACTAAGGAGGAAGG - Intergenic
945411842 2:209519103-209519125 TTTTCTATTACTTTGGTGGAGGG - Intronic
947552783 2:231058473-231058495 TTTTTTCTTACTGTGGTGGTCGG + Intronic
1169023052 20:2344458-2344480 TTTTGGCTGCCTAAGGTGGAAGG - Intergenic
1169666847 20:8047146-8047168 TTTTATTTTGCCAAGGTTGAGGG - Intergenic
1171265234 20:23766330-23766352 TTTCATTTTACTAAGGAGTAAGG - Intergenic
1174660802 20:52211251-52211273 TTTTAGATTACTAAGGAGCAAGG - Intergenic
1177365619 21:20132063-20132085 GTTTATCTTGCCAAGGTTGAGGG + Intergenic
1177649222 21:23939068-23939090 GTTTATTTAACTAAGGTTGAGGG - Intergenic
1177724207 21:24945977-24945999 TTTTAACTTACTAAACTTGAAGG - Intergenic
1177827472 21:26100497-26100519 TTTAATCTTACCGAGTTGGAAGG - Intronic
1185144155 22:49120709-49120731 GTTTATTTTGCCAAGGTGGAGGG + Intergenic
949187453 3:1209943-1209965 ATACATCTTACTAAGGTGGTGGG - Intronic
950227486 3:11247799-11247821 GTTTATCTGAATAAGGTGGGGGG + Intronic
953121525 3:40047432-40047454 TTTTATTTTAAGAAAGTGGAGGG + Intronic
953212445 3:40888105-40888127 CTGTATTTTACCAAGGTGGAAGG - Intergenic
955157902 3:56435364-56435386 TTTTATCTTGCTTAGGGGCAGGG - Intronic
957183564 3:76913096-76913118 TTTTAAATTAATAAGGTGGGAGG + Intronic
957331023 3:78763980-78764002 TTTTATTTTAGTTAGATGGAGGG + Intronic
957846913 3:85748767-85748789 TTTTATCTTTCTAAACTGTAAGG + Intronic
959420542 3:106122927-106122949 GTTTATATCACTAAGGTAGATGG - Intergenic
964787480 3:160414149-160414171 TTTTGCCTTTCTAAGTTGGAGGG - Intronic
969003867 4:4004127-4004149 TTTCCTCTTAATAAGGTGGCTGG - Intergenic
969401337 4:6957647-6957669 TTTTATCTTAGAAAGTTAGAGGG + Intronic
971357144 4:25905465-25905487 TTGTATCTTAACATGGTGGAAGG - Intronic
971548121 4:27913356-27913378 ATTTCTCTTGCTAATGTGGATGG + Intergenic
972079464 4:35132024-35132046 CTTCATCTTACTAAAGTTGAGGG + Intergenic
972438966 4:39066053-39066075 TTTTAAATCACTTAGGTGGATGG - Intronic
974213571 4:58815369-58815391 CTCTATCTTACTAAGTTAGATGG + Intergenic
975422238 4:74180388-74180410 TTTTATATTATTAAGCTTGAAGG - Intronic
975535830 4:75449099-75449121 TTATATCTTTTTATGGTGGATGG + Intergenic
981158888 4:141473322-141473344 TTTTATCATACTAAAGAAGAAGG + Intergenic
982814468 4:159868728-159868750 TTGTATCTAACTAATGTGGTGGG - Intergenic
983658263 4:170105466-170105488 TTTTTTCTTTCTAATTTGGATGG - Intergenic
984937810 4:184904696-184904718 TTTTATCGTAATATGGTGGAGGG - Intergenic
985770517 5:1807321-1807343 TTTCAGTTTACGAAGGTGGAAGG + Intronic
986019520 5:3788343-3788365 TTTTATGTTATTTAGGAGGAAGG - Intergenic
986256355 5:6104105-6104127 TTTTGTCTTCATATGGTGGAGGG + Intergenic
987556993 5:19465273-19465295 TTTTGTCTTACTAAGTCTGAAGG + Intergenic
987922084 5:24296302-24296324 TTTCAACATACTAAGTTGGAAGG - Intergenic
988165004 5:27576154-27576176 TTATATATACCTAAGGTGGACGG - Intergenic
988870158 5:35380549-35380571 TCATATCTTACTAACATGGATGG - Intergenic
990518842 5:56557733-56557755 TTTTATCTTTCTAGGGAGCAGGG + Intronic
994354904 5:98783960-98783982 TTTTGTGTTACTGAGGTGGAAGG - Intronic
995840995 5:116443108-116443130 TTACATATTAATAAGGTGGAGGG - Intergenic
995856933 5:116602723-116602745 GTTTATCTTAGAAAGGTGAAAGG + Intergenic
995906035 5:117124854-117124876 ATTTCCCTTACCAAGGTGGAAGG + Intergenic
998022651 5:138784010-138784032 TATTATGTTACAAATGTGGAAGG + Intronic
998610430 5:143682509-143682531 TTTTCTGTCACTAGGGTGGAGGG + Intergenic
1002650433 5:180687897-180687919 CTGTAGCTTCCTAAGGTGGAAGG - Intergenic
1003881831 6:10486207-10486229 GATTATCTTCCTAATGTGGATGG + Intergenic
1006264461 6:32907205-32907227 TTTTATCTGAATAGGGTGGATGG - Intergenic
1007197736 6:40077278-40077300 TTTATTCTTACTAAAGTGTATGG + Intergenic
1008064422 6:47032162-47032184 TTTTATTTTTTTAAGGAGGAGGG - Intronic
1009219062 6:60961255-60961277 GTTTAAATTACTGAGGTGGAAGG + Intergenic
1013619926 6:111878288-111878310 TTTTCTCTTAAAAAGATGGAGGG + Intergenic
1014487079 6:122012364-122012386 TTTTCTCTTATTAAAGTTGAAGG + Intergenic
1014504347 6:122235231-122235253 TTTTAGCTTCTTCAGGTGGAAGG - Intergenic
1017150772 6:151277996-151278018 CTTTGTCTTACTATTGTGGAAGG + Intronic
1018733788 6:166672595-166672617 TTTTTTCTTACTATTTTGGATGG - Intronic
1022628855 7:32066261-32066283 TGTTAGCATAGTAAGGTGGATGG + Intronic
1023325210 7:39047457-39047479 TTTTATGTTACTATTGTGAATGG + Intronic
1023498693 7:40825582-40825604 TTTTCCCTTACTCATGTGGAGGG - Intronic
1024555925 7:50603701-50603723 TTTTATCTTCATAAGGTAGTGGG - Intronic
1027450786 7:78328802-78328824 TCTTATCTGACTATGGGGGATGG - Intronic
1029317044 7:99724716-99724738 TTTTCTCTTAGTCAGGTGGCTGG + Intronic
1030326622 7:108226428-108226450 ATTTATCTTGCTAATTTGGAGGG - Intronic
1031296560 7:120010678-120010700 TTTTCTCTTAAAAAGGTGGCTGG + Intergenic
1032646814 7:133834039-133834061 TTATATCTTACTAATATGCAGGG - Intronic
1033300761 7:140183031-140183053 TTTAATTTTACTGAGCTGGAGGG + Intergenic
1033796064 7:144846331-144846353 TTTTAGCTTTTTAAGTTGGAAGG + Intergenic
1034792677 7:153985541-153985563 TTTTATCTTGGTGTGGTGGATGG + Intronic
1035715245 8:1749131-1749153 TTTTATGTTACAAAGATAGATGG - Intergenic
1037060776 8:14506710-14506732 TTTTATGTTACTAAATTGAATGG + Intronic
1039937331 8:42057070-42057092 TTTTTTTTTACTGAGGGGGAAGG - Intergenic
1042289861 8:67158736-67158758 TATTATTTTATTAAGGTGAAAGG + Intronic
1043103565 8:76079645-76079667 TTTTACATTCCTAAGGAGGACGG - Intergenic
1043267154 8:78280410-78280432 TTTTATTTTACAAAGGTGGAGGG - Intergenic
1043395733 8:79834129-79834151 ATTTATCTTGCTAAGGTAAATGG - Intergenic
1043524351 8:81080388-81080410 TTTTATCTTAATAATTTGGGTGG - Intronic
1043529925 8:81137924-81137946 TTTTATCTTATGAAGTTGTAAGG - Intergenic
1044195504 8:89372507-89372529 TTTGATTTTATTAAGGGGGAGGG - Intergenic
1045162597 8:99565782-99565804 TTTTATCTTACTAATTTGTGAGG + Intronic
1046165563 8:110430189-110430211 TTTTATTTTGCTAATGTGTATGG + Intergenic
1050817287 9:9831781-9831803 TGTTATTTCACCAAGGTGGAGGG + Intronic
1051819036 9:21143099-21143121 TTTTGTCTAAGGAAGGTGGAAGG + Intergenic
1052163028 9:25289494-25289516 TTTCCTCTTAATAAGGTGGCTGG + Intergenic
1052240945 9:26272645-26272667 TTTTAACTTTGTAAGCTGGATGG - Intergenic
1056214016 9:84391517-84391539 CTTTAACTTGCTAAGGTGCAGGG + Intergenic
1056392175 9:86150546-86150568 ATTTATCTTTTTAAGGAGGAAGG + Intergenic
1056721223 9:89073732-89073754 TTCTATTTTACTGAGGTGGGAGG + Intronic
1058186435 9:101860829-101860851 TCATTTCTTACTAAGGTGTATGG - Intergenic
1059968851 9:119643547-119643569 AATTATCATATTAAGGTGGAGGG + Intergenic
1185575752 X:1170877-1170899 ACTTATCTTACTGAGGTGTAGGG + Intergenic
1187242412 X:17525651-17525673 TTTTTTTTTACTACAGTGGAAGG + Intronic
1187573569 X:20530648-20530670 TGTTCTCTTACTTGGGTGGAAGG + Intergenic
1188110121 X:26187311-26187333 TTGTACTTTTCTAAGGTGGAAGG - Intergenic
1188422592 X:30008126-30008148 TTTTATCTTCCTAAGGTTTGGGG - Intergenic
1190464376 X:50711060-50711082 TTTAATGTTACTAAGGTATAAGG - Intronic
1195513880 X:105749435-105749457 TTGCTTCTTACTAAGGGGGAGGG - Intronic
1197507430 X:127323837-127323859 ATTTATCTTACTAAAGTGTGAGG + Intergenic
1201233186 Y:11885613-11885635 TTTTATGTTACTACGGAGGCTGG + Intergenic