ID: 1116215268

View in Genome Browser
Species Human (GRCh38)
Location 14:42008683-42008705
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116215268_1116215271 -6 Left 1116215268 14:42008683-42008705 CCTCTGACCTGCAACATCCGGGT No data
Right 1116215271 14:42008700-42008722 CCGGGTAGTTCAAGTAGAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116215268 Original CRISPR ACCCGGATGTTGCAGGTCAG AGG (reversed) Intergenic
No off target data available for this crispr