ID: 1116231984

View in Genome Browser
Species Human (GRCh38)
Location 14:42229305-42229327
Sequence GCTCCTCAGCACCATGCATG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116231981_1116231984 -9 Left 1116231981 14:42229291-42229313 CCTCCAGCCTGTCAGCTCCTCAG No data
Right 1116231984 14:42229305-42229327 GCTCCTCAGCACCATGCATGTGG No data
1116231972_1116231984 29 Left 1116231972 14:42229253-42229275 CCAGTGGGCCTTGCCTGTAAGGA No data
Right 1116231984 14:42229305-42229327 GCTCCTCAGCACCATGCATGTGG No data
1116231976_1116231984 21 Left 1116231976 14:42229261-42229283 CCTTGCCTGTAAGGAGCAGGGGA No data
Right 1116231984 14:42229305-42229327 GCTCCTCAGCACCATGCATGTGG No data
1116231977_1116231984 16 Left 1116231977 14:42229266-42229288 CCTGTAAGGAGCAGGGGAAGTGG No data
Right 1116231984 14:42229305-42229327 GCTCCTCAGCACCATGCATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116231984 Original CRISPR GCTCCTCAGCACCATGCATG TGG Intergenic
No off target data available for this crispr