ID: 1116233511

View in Genome Browser
Species Human (GRCh38)
Location 14:42248292-42248314
Sequence GTCTTTAAGGAGATTATGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116233506_1116233511 -1 Left 1116233506 14:42248270-42248292 CCTCAAGGGGTATTGGGCAGGGG No data
Right 1116233511 14:42248292-42248314 GTCTTTAAGGAGATTATGGAGGG No data
1116233499_1116233511 13 Left 1116233499 14:42248256-42248278 CCTCAAATCTATTTCCTCAAGGG No data
Right 1116233511 14:42248292-42248314 GTCTTTAAGGAGATTATGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116233511 Original CRISPR GTCTTTAAGGAGATTATGGA GGG Intergenic
No off target data available for this crispr