ID: 1116233511 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 14:42248292-42248314 |
Sequence | GTCTTTAAGGAGATTATGGA GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1116233506_1116233511 | -1 | Left | 1116233506 | 14:42248270-42248292 | CCTCAAGGGGTATTGGGCAGGGG | No data | ||
Right | 1116233511 | 14:42248292-42248314 | GTCTTTAAGGAGATTATGGAGGG | No data | ||||
1116233499_1116233511 | 13 | Left | 1116233499 | 14:42248256-42248278 | CCTCAAATCTATTTCCTCAAGGG | No data | ||
Right | 1116233511 | 14:42248292-42248314 | GTCTTTAAGGAGATTATGGAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1116233511 | Original CRISPR | GTCTTTAAGGAGATTATGGA GGG | Intergenic | ||
No off target data available for this crispr |