ID: 1116234949

View in Genome Browser
Species Human (GRCh38)
Location 14:42268088-42268110
Sequence ATGCCCTTCTAGAAAAGTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116234944_1116234949 28 Left 1116234944 14:42268037-42268059 CCAATCATTGCTTCTTTTACTCC No data
Right 1116234949 14:42268088-42268110 ATGCCCTTCTAGAAAAGTGAAGG No data
1116234947_1116234949 7 Left 1116234947 14:42268058-42268080 CCAAACTATGGAAAAAGGACCTA No data
Right 1116234949 14:42268088-42268110 ATGCCCTTCTAGAAAAGTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116234949 Original CRISPR ATGCCCTTCTAGAAAAGTGA AGG Intergenic
No off target data available for this crispr