ID: 1116236377

View in Genome Browser
Species Human (GRCh38)
Location 14:42284658-42284680
Sequence ATGCAACTCCTCCCCAGCAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116236377_1116236383 4 Left 1116236377 14:42284658-42284680 CCCTTGCTGGGGAGGAGTTGCAT No data
Right 1116236383 14:42284685-42284707 TTGGAGGAGAGGATGCATTCTGG No data
1116236377_1116236381 -7 Left 1116236377 14:42284658-42284680 CCCTTGCTGGGGAGGAGTTGCAT No data
Right 1116236381 14:42284674-42284696 GTTGCATTCCTTTGGAGGAGAGG No data
1116236377_1116236384 11 Left 1116236377 14:42284658-42284680 CCCTTGCTGGGGAGGAGTTGCAT No data
Right 1116236384 14:42284692-42284714 AGAGGATGCATTCTGGTTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116236377 Original CRISPR ATGCAACTCCTCCCCAGCAA GGG (reversed) Intergenic
No off target data available for this crispr