ID: 1116239537

View in Genome Browser
Species Human (GRCh38)
Location 14:42323423-42323445
Sequence GGCCCCAATCCTGGTGGTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116239526_1116239537 27 Left 1116239526 14:42323373-42323395 CCATCAGCTATCTCCTGCAATAG No data
Right 1116239537 14:42323423-42323445 GGCCCCAATCCTGGTGGTACTGG No data
1116239525_1116239537 28 Left 1116239525 14:42323372-42323394 CCCATCAGCTATCTCCTGCAATA No data
Right 1116239537 14:42323423-42323445 GGCCCCAATCCTGGTGGTACTGG No data
1116239528_1116239537 14 Left 1116239528 14:42323386-42323408 CCTGCAATAGACACAGGTTTGAC No data
Right 1116239537 14:42323423-42323445 GGCCCCAATCCTGGTGGTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116239537 Original CRISPR GGCCCCAATCCTGGTGGTAC TGG Intergenic
No off target data available for this crispr