ID: 1116241493

View in Genome Browser
Species Human (GRCh38)
Location 14:42348811-42348833
Sequence AAGCCATGATGTTAGATCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116241490_1116241493 28 Left 1116241490 14:42348760-42348782 CCTCTAAGTGAACAAAGAAGGGT No data
Right 1116241493 14:42348811-42348833 AAGCCATGATGTTAGATCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116241493 Original CRISPR AAGCCATGATGTTAGATCAG TGG Intergenic
No off target data available for this crispr