ID: 1116249274

View in Genome Browser
Species Human (GRCh38)
Location 14:42459324-42459346
Sequence TAGGGAGTTACAGTGTTTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116249266_1116249274 25 Left 1116249266 14:42459276-42459298 CCACCTGGCCACTTTGGGCTCCT 0: 33
1: 193
2: 278
3: 216
4: 511
Right 1116249274 14:42459324-42459346 TAGGGAGTTACAGTGTTTGCTGG No data
1116249267_1116249274 22 Left 1116249267 14:42459279-42459301 CCTGGCCACTTTGGGCTCCTGCT No data
Right 1116249274 14:42459324-42459346 TAGGGAGTTACAGTGTTTGCTGG No data
1116249268_1116249274 17 Left 1116249268 14:42459284-42459306 CCACTTTGGGCTCCTGCTACCTT No data
Right 1116249274 14:42459324-42459346 TAGGGAGTTACAGTGTTTGCTGG No data
1116249271_1116249274 -2 Left 1116249271 14:42459303-42459325 CCTTTAAGTCAACAGGATAAGTA No data
Right 1116249274 14:42459324-42459346 TAGGGAGTTACAGTGTTTGCTGG No data
1116249269_1116249274 5 Left 1116249269 14:42459296-42459318 CCTGCTACCTTTAAGTCAACAGG No data
Right 1116249274 14:42459324-42459346 TAGGGAGTTACAGTGTTTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116249274 Original CRISPR TAGGGAGTTACAGTGTTTGC TGG Intergenic
No off target data available for this crispr