ID: 1116252065

View in Genome Browser
Species Human (GRCh38)
Location 14:42499058-42499080
Sequence TATGAAGGAACACCCAACAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116252065_1116252068 17 Left 1116252065 14:42499058-42499080 CCAGTGTTGGGTGTTCCTTCATA No data
Right 1116252068 14:42499098-42499120 TAATACACCTACTATGTACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116252065 Original CRISPR TATGAAGGAACACCCAACAC TGG (reversed) Intergenic
No off target data available for this crispr