ID: 1116252068

View in Genome Browser
Species Human (GRCh38)
Location 14:42499098-42499120
Sequence TAATACACCTACTATGTACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116252066_1116252068 2 Left 1116252066 14:42499073-42499095 CCTTCATAACAATGCAAGAGTGA No data
Right 1116252068 14:42499098-42499120 TAATACACCTACTATGTACCAGG No data
1116252065_1116252068 17 Left 1116252065 14:42499058-42499080 CCAGTGTTGGGTGTTCCTTCATA No data
Right 1116252068 14:42499098-42499120 TAATACACCTACTATGTACCAGG No data
1116252064_1116252068 18 Left 1116252064 14:42499057-42499079 CCCAGTGTTGGGTGTTCCTTCAT No data
Right 1116252068 14:42499098-42499120 TAATACACCTACTATGTACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116252068 Original CRISPR TAATACACCTACTATGTACC AGG Intergenic
No off target data available for this crispr