ID: 1116261480

View in Genome Browser
Species Human (GRCh38)
Location 14:42633957-42633979
Sequence AAATTGCAACAAATTTAACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116261479_1116261480 1 Left 1116261479 14:42633933-42633955 CCTAGCTTTATTCTGTCAAAGCA No data
Right 1116261480 14:42633957-42633979 AAATTGCAACAAATTTAACCAGG No data
1116261478_1116261480 12 Left 1116261478 14:42633922-42633944 CCTCATGACTGCCTAGCTTTATT No data
Right 1116261480 14:42633957-42633979 AAATTGCAACAAATTTAACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116261480 Original CRISPR AAATTGCAACAAATTTAACC AGG Intergenic
No off target data available for this crispr