ID: 1116264250

View in Genome Browser
Species Human (GRCh38)
Location 14:42666213-42666235
Sequence ATGAATAAATGCTCTAATTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116264250_1116264254 19 Left 1116264250 14:42666213-42666235 CCTTAATTAGAGCATTTATTCAT No data
Right 1116264254 14:42666255-42666277 GCTACTTGGGTAGCTGAGGCAGG 0: 29
1: 3951
2: 85052
3: 187065
4: 223574
1116264250_1116264251 5 Left 1116264250 14:42666213-42666235 CCTTAATTAGAGCATTTATTCAT No data
Right 1116264251 14:42666241-42666263 CATTCACTCATTCAGCTACTTGG No data
1116264250_1116264253 15 Left 1116264250 14:42666213-42666235 CCTTAATTAGAGCATTTATTCAT No data
Right 1116264253 14:42666251-42666273 TTCAGCTACTTGGGTAGCTGAGG No data
1116264250_1116264252 6 Left 1116264250 14:42666213-42666235 CCTTAATTAGAGCATTTATTCAT No data
Right 1116264252 14:42666242-42666264 ATTCACTCATTCAGCTACTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116264250 Original CRISPR ATGAATAAATGCTCTAATTA AGG (reversed) Intergenic
No off target data available for this crispr