ID: 1116269518

View in Genome Browser
Species Human (GRCh38)
Location 14:42743048-42743070
Sequence GTGCCCACCCAGACTGAGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116269510_1116269518 29 Left 1116269510 14:42742996-42743018 CCACGTTCCTCTTCTTCCTGTTA No data
Right 1116269518 14:42743048-42743070 GTGCCCACCCAGACTGAGGTTGG No data
1116269513_1116269518 13 Left 1116269513 14:42743012-42743034 CCTGTTATCCTAGCCATGCTGGC No data
Right 1116269518 14:42743048-42743070 GTGCCCACCCAGACTGAGGTTGG No data
1116269514_1116269518 5 Left 1116269514 14:42743020-42743042 CCTAGCCATGCTGGCAGCTGATT 0: 53
1: 93
2: 145
3: 168
4: 367
Right 1116269518 14:42743048-42743070 GTGCCCACCCAGACTGAGGTTGG No data
1116269515_1116269518 0 Left 1116269515 14:42743025-42743047 CCATGCTGGCAGCTGATTAAATG No data
Right 1116269518 14:42743048-42743070 GTGCCCACCCAGACTGAGGTTGG No data
1116269511_1116269518 22 Left 1116269511 14:42743003-42743025 CCTCTTCTTCCTGTTATCCTAGC No data
Right 1116269518 14:42743048-42743070 GTGCCCACCCAGACTGAGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116269518 Original CRISPR GTGCCCACCCAGACTGAGGT TGG Intergenic
No off target data available for this crispr