ID: 1116269854

View in Genome Browser
Species Human (GRCh38)
Location 14:42749280-42749302
Sequence TCCTCTCTCATCAATCAGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116269854_1116269857 30 Left 1116269854 14:42749280-42749302 CCCCACTGATTGATGAGAGAGGA No data
Right 1116269857 14:42749333-42749355 AGAGAGAGAGAAACAGTCTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116269854 Original CRISPR TCCTCTCTCATCAATCAGTG GGG (reversed) Intergenic
No off target data available for this crispr