ID: 1116277861

View in Genome Browser
Species Human (GRCh38)
Location 14:42859964-42859986
Sequence GTTCCTACCTCCATGGTGTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116277858_1116277861 15 Left 1116277858 14:42859926-42859948 CCTTTTTTACCTTGATCATGTGT No data
Right 1116277861 14:42859964-42859986 GTTCCTACCTCCATGGTGTATGG No data
1116277859_1116277861 6 Left 1116277859 14:42859935-42859957 CCTTGATCATGTGTCTCAATCAT No data
Right 1116277861 14:42859964-42859986 GTTCCTACCTCCATGGTGTATGG No data
1116277857_1116277861 24 Left 1116277857 14:42859917-42859939 CCAAGTTCTCCTTTTTTACCTTG No data
Right 1116277861 14:42859964-42859986 GTTCCTACCTCCATGGTGTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116277861 Original CRISPR GTTCCTACCTCCATGGTGTA TGG Intergenic
No off target data available for this crispr