ID: 1116282422

View in Genome Browser
Species Human (GRCh38)
Location 14:42926456-42926478
Sequence CAGGTGTCATTGCATGAGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116282418_1116282422 -2 Left 1116282418 14:42926435-42926457 CCATACCTTTATTTGAGCTTACA No data
Right 1116282422 14:42926456-42926478 CAGGTGTCATTGCATGAGATGGG No data
1116282420_1116282422 -7 Left 1116282420 14:42926440-42926462 CCTTTATTTGAGCTTACAGGTGT No data
Right 1116282422 14:42926456-42926478 CAGGTGTCATTGCATGAGATGGG No data
1116282417_1116282422 22 Left 1116282417 14:42926411-42926433 CCTGTTTGCTTGGTAGGTTTTTC No data
Right 1116282422 14:42926456-42926478 CAGGTGTCATTGCATGAGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116282422 Original CRISPR CAGGTGTCATTGCATGAGAT GGG Intergenic
No off target data available for this crispr