ID: 1116287715

View in Genome Browser
Species Human (GRCh38)
Location 14:42993735-42993757
Sequence GAGGTGGCTCAGAAATATGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116287711_1116287715 1 Left 1116287711 14:42993711-42993733 CCTGCTGCACTAAAAACCAACTC No data
Right 1116287715 14:42993735-42993757 GAGGTGGCTCAGAAATATGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116287715 Original CRISPR GAGGTGGCTCAGAAATATGT TGG Intergenic
No off target data available for this crispr