ID: 1116288586

View in Genome Browser
Species Human (GRCh38)
Location 14:43004382-43004404
Sequence AGATGTTTTCTACAGTTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116288579_1116288586 23 Left 1116288579 14:43004336-43004358 CCTGGCCTCCTGAGGGAAGTGTT No data
Right 1116288586 14:43004382-43004404 AGATGTTTTCTACAGTTGGGAGG No data
1116288582_1116288586 -10 Left 1116288582 14:43004369-43004391 CCCTCTGATAACTAGATGTTTTC No data
Right 1116288586 14:43004382-43004404 AGATGTTTTCTACAGTTGGGAGG No data
1116288580_1116288586 18 Left 1116288580 14:43004341-43004363 CCTCCTGAGGGAAGTGTTAATTA No data
Right 1116288586 14:43004382-43004404 AGATGTTTTCTACAGTTGGGAGG No data
1116288581_1116288586 15 Left 1116288581 14:43004344-43004366 CCTGAGGGAAGTGTTAATTATAA No data
Right 1116288586 14:43004382-43004404 AGATGTTTTCTACAGTTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116288586 Original CRISPR AGATGTTTTCTACAGTTGGG AGG Intergenic
No off target data available for this crispr