ID: 1116290284

View in Genome Browser
Species Human (GRCh38)
Location 14:43026444-43026466
Sequence CAGGAAGCCTACAATTATGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116290284_1116290286 2 Left 1116290284 14:43026444-43026466 CCATCATAATTGTAGGCTTCCTG No data
Right 1116290286 14:43026469-43026491 GCCTCCTCAGAAGCAGATGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116290284 Original CRISPR CAGGAAGCCTACAATTATGA TGG (reversed) Intergenic
No off target data available for this crispr