ID: 1116300163

View in Genome Browser
Species Human (GRCh38)
Location 14:43169676-43169698
Sequence CTATGTAAGCAATACATTTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116300161_1116300163 -8 Left 1116300161 14:43169661-43169683 CCTAAAAGGGCCTTTCTATGTAA No data
Right 1116300163 14:43169676-43169698 CTATGTAAGCAATACATTTATGG No data
1116300158_1116300163 13 Left 1116300158 14:43169640-43169662 CCTTCGAAGTCATAAATTTAACC No data
Right 1116300163 14:43169676-43169698 CTATGTAAGCAATACATTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116300163 Original CRISPR CTATGTAAGCAATACATTTA TGG Intergenic
No off target data available for this crispr