ID: 1116308043

View in Genome Browser
Species Human (GRCh38)
Location 14:43283436-43283458
Sequence GACAGCTCTTGGCCTGCTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116308043_1116308049 16 Left 1116308043 14:43283436-43283458 CCAGTAGCAGGCCAAGAGCTGTC No data
Right 1116308049 14:43283475-43283497 GTTATCTGCAGAAGATGGTAGGG 0: 7
1: 193
2: 178
3: 130
4: 224
1116308043_1116308047 11 Left 1116308043 14:43283436-43283458 CCAGTAGCAGGCCAAGAGCTGTC No data
Right 1116308047 14:43283470-43283492 GAATAGTTATCTGCAGAAGATGG 0: 14
1: 194
2: 203
3: 139
4: 330
1116308043_1116308048 15 Left 1116308043 14:43283436-43283458 CCAGTAGCAGGCCAAGAGCTGTC No data
Right 1116308048 14:43283474-43283496 AGTTATCTGCAGAAGATGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116308043 Original CRISPR GACAGCTCTTGGCCTGCTAC TGG (reversed) Intergenic
No off target data available for this crispr