ID: 1116308045

View in Genome Browser
Species Human (GRCh38)
Location 14:43283447-43283469
Sequence TCCTTTGGAAAGACAGCTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116308045_1116308052 27 Left 1116308045 14:43283447-43283469 CCAAGAGCTGTCTTTCCAAAGGA No data
Right 1116308052 14:43283497-43283519 GCATTGCTCCAAAATCCTAGGGG No data
1116308045_1116308047 0 Left 1116308045 14:43283447-43283469 CCAAGAGCTGTCTTTCCAAAGGA No data
Right 1116308047 14:43283470-43283492 GAATAGTTATCTGCAGAAGATGG 0: 14
1: 194
2: 203
3: 139
4: 330
1116308045_1116308050 25 Left 1116308045 14:43283447-43283469 CCAAGAGCTGTCTTTCCAAAGGA No data
Right 1116308050 14:43283495-43283517 GGGCATTGCTCCAAAATCCTAGG No data
1116308045_1116308048 4 Left 1116308045 14:43283447-43283469 CCAAGAGCTGTCTTTCCAAAGGA No data
Right 1116308048 14:43283474-43283496 AGTTATCTGCAGAAGATGGTAGG No data
1116308045_1116308049 5 Left 1116308045 14:43283447-43283469 CCAAGAGCTGTCTTTCCAAAGGA No data
Right 1116308049 14:43283475-43283497 GTTATCTGCAGAAGATGGTAGGG 0: 7
1: 193
2: 178
3: 130
4: 224
1116308045_1116308051 26 Left 1116308045 14:43283447-43283469 CCAAGAGCTGTCTTTCCAAAGGA No data
Right 1116308051 14:43283496-43283518 GGCATTGCTCCAAAATCCTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116308045 Original CRISPR TCCTTTGGAAAGACAGCTCT TGG (reversed) Intergenic
No off target data available for this crispr