ID: 1116308048

View in Genome Browser
Species Human (GRCh38)
Location 14:43283474-43283496
Sequence AGTTATCTGCAGAAGATGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116308045_1116308048 4 Left 1116308045 14:43283447-43283469 CCAAGAGCTGTCTTTCCAAAGGA No data
Right 1116308048 14:43283474-43283496 AGTTATCTGCAGAAGATGGTAGG No data
1116308043_1116308048 15 Left 1116308043 14:43283436-43283458 CCAGTAGCAGGCCAAGAGCTGTC No data
Right 1116308048 14:43283474-43283496 AGTTATCTGCAGAAGATGGTAGG No data
1116308042_1116308048 16 Left 1116308042 14:43283435-43283457 CCCAGTAGCAGGCCAAGAGCTGT No data
Right 1116308048 14:43283474-43283496 AGTTATCTGCAGAAGATGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116308048 Original CRISPR AGTTATCTGCAGAAGATGGT AGG Intergenic
No off target data available for this crispr