ID: 1116317075

View in Genome Browser
Species Human (GRCh38)
Location 14:43410731-43410753
Sequence TGGGCATCCCTGTACTCTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116317075_1116317081 0 Left 1116317075 14:43410731-43410753 CCCTGAGAGTACAGGGATGCCCA No data
Right 1116317081 14:43410754-43410776 GGTCTGTAGCTGCAGCCAGGAGG No data
1116317075_1116317082 1 Left 1116317075 14:43410731-43410753 CCCTGAGAGTACAGGGATGCCCA No data
Right 1116317082 14:43410755-43410777 GTCTGTAGCTGCAGCCAGGAGGG No data
1116317075_1116317083 5 Left 1116317075 14:43410731-43410753 CCCTGAGAGTACAGGGATGCCCA No data
Right 1116317083 14:43410759-43410781 GTAGCTGCAGCCAGGAGGGCAGG No data
1116317075_1116317086 29 Left 1116317075 14:43410731-43410753 CCCTGAGAGTACAGGGATGCCCA No data
Right 1116317086 14:43410783-43410805 CTCCCACCCCGCCAAGTAGAAGG No data
1116317075_1116317080 -3 Left 1116317075 14:43410731-43410753 CCCTGAGAGTACAGGGATGCCCA No data
Right 1116317080 14:43410751-43410773 CCAGGTCTGTAGCTGCAGCCAGG No data
1116317075_1116317084 6 Left 1116317075 14:43410731-43410753 CCCTGAGAGTACAGGGATGCCCA No data
Right 1116317084 14:43410760-43410782 TAGCTGCAGCCAGGAGGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116317075 Original CRISPR TGGGCATCCCTGTACTCTCA GGG (reversed) Intergenic
No off target data available for this crispr