ID: 1116318886

View in Genome Browser
Species Human (GRCh38)
Location 14:43434227-43434249
Sequence TTGCTTGGGGGCAATATTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116318886_1116318891 1 Left 1116318886 14:43434227-43434249 CCTGAAATATTGCCCCCAAGCAA No data
Right 1116318891 14:43434251-43434273 ACTTTTATCCTGTTCTTAAAAGG No data
1116318886_1116318893 24 Left 1116318886 14:43434227-43434249 CCTGAAATATTGCCCCCAAGCAA No data
Right 1116318893 14:43434274-43434296 CTTGAGACCTGACATTGACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116318886 Original CRISPR TTGCTTGGGGGCAATATTTC AGG (reversed) Intergenic
No off target data available for this crispr