ID: 1116318887 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 14:43434239-43434261 |
| Sequence | AGGATAAAAGTCTTGCTTGG GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1116318887_1116318895 | 23 | Left | 1116318887 | 14:43434239-43434261 | CCCCCAAGCAAGACTTTTATCCT | No data | ||
| Right | 1116318895 | 14:43434285-43434307 | ACATTGACTTGGCCTCCTTATGG | No data | ||||
| 1116318887_1116318893 | 12 | Left | 1116318887 | 14:43434239-43434261 | CCCCCAAGCAAGACTTTTATCCT | No data | ||
| Right | 1116318893 | 14:43434274-43434296 | CTTGAGACCTGACATTGACTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1116318887 | Original CRISPR | AGGATAAAAGTCTTGCTTGG GGG (reversed) | Intergenic | ||