ID: 1116318889

View in Genome Browser
Species Human (GRCh38)
Location 14:43434241-43434263
Sequence ACAGGATAAAAGTCTTGCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 224
Summary {0: 1, 1: 3, 2: 11, 3: 14, 4: 195}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116318889_1116318895 21 Left 1116318889 14:43434241-43434263 CCCAAGCAAGACTTTTATCCTGT 0: 1
1: 3
2: 11
3: 14
4: 195
Right 1116318895 14:43434285-43434307 ACATTGACTTGGCCTCCTTATGG No data
1116318889_1116318893 10 Left 1116318889 14:43434241-43434263 CCCAAGCAAGACTTTTATCCTGT 0: 1
1: 3
2: 11
3: 14
4: 195
Right 1116318893 14:43434274-43434296 CTTGAGACCTGACATTGACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116318889 Original CRISPR ACAGGATAAAAGTCTTGCTT GGG (reversed) Intergenic