ID: 1116318890

View in Genome Browser
Species Human (GRCh38)
Location 14:43434242-43434264
Sequence AACAGGATAAAAGTCTTGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116318890_1116318895 20 Left 1116318890 14:43434242-43434264 CCAAGCAAGACTTTTATCCTGTT No data
Right 1116318895 14:43434285-43434307 ACATTGACTTGGCCTCCTTATGG No data
1116318890_1116318893 9 Left 1116318890 14:43434242-43434264 CCAAGCAAGACTTTTATCCTGTT No data
Right 1116318893 14:43434274-43434296 CTTGAGACCTGACATTGACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116318890 Original CRISPR AACAGGATAAAAGTCTTGCT TGG (reversed) Intergenic
No off target data available for this crispr