ID: 1116318892

View in Genome Browser
Species Human (GRCh38)
Location 14:43434259-43434281
Sequence GTCTCAAGCCTTTTAAGAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116318892_1116318895 3 Left 1116318892 14:43434259-43434281 CCTGTTCTTAAAAGGCTTGAGAC No data
Right 1116318895 14:43434285-43434307 ACATTGACTTGGCCTCCTTATGG No data
1116318892_1116318893 -8 Left 1116318892 14:43434259-43434281 CCTGTTCTTAAAAGGCTTGAGAC No data
Right 1116318893 14:43434274-43434296 CTTGAGACCTGACATTGACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116318892 Original CRISPR GTCTCAAGCCTTTTAAGAAC AGG (reversed) Intergenic