ID: 1116318893

View in Genome Browser
Species Human (GRCh38)
Location 14:43434274-43434296
Sequence CTTGAGACCTGACATTGACT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116318887_1116318893 12 Left 1116318887 14:43434239-43434261 CCCCCAAGCAAGACTTTTATCCT No data
Right 1116318893 14:43434274-43434296 CTTGAGACCTGACATTGACTTGG No data
1116318888_1116318893 11 Left 1116318888 14:43434240-43434262 CCCCAAGCAAGACTTTTATCCTG No data
Right 1116318893 14:43434274-43434296 CTTGAGACCTGACATTGACTTGG No data
1116318890_1116318893 9 Left 1116318890 14:43434242-43434264 CCAAGCAAGACTTTTATCCTGTT No data
Right 1116318893 14:43434274-43434296 CTTGAGACCTGACATTGACTTGG No data
1116318892_1116318893 -8 Left 1116318892 14:43434259-43434281 CCTGTTCTTAAAAGGCTTGAGAC No data
Right 1116318893 14:43434274-43434296 CTTGAGACCTGACATTGACTTGG No data
1116318889_1116318893 10 Left 1116318889 14:43434241-43434263 CCCAAGCAAGACTTTTATCCTGT No data
Right 1116318893 14:43434274-43434296 CTTGAGACCTGACATTGACTTGG No data
1116318886_1116318893 24 Left 1116318886 14:43434227-43434249 CCTGAAATATTGCCCCCAAGCAA No data
Right 1116318893 14:43434274-43434296 CTTGAGACCTGACATTGACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116318893 Original CRISPR CTTGAGACCTGACATTGACT TGG Intergenic
No off target data available for this crispr