ID: 1116318895

View in Genome Browser
Species Human (GRCh38)
Location 14:43434285-43434307
Sequence ACATTGACTTGGCCTCCTTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116318889_1116318895 21 Left 1116318889 14:43434241-43434263 CCCAAGCAAGACTTTTATCCTGT No data
Right 1116318895 14:43434285-43434307 ACATTGACTTGGCCTCCTTATGG No data
1116318887_1116318895 23 Left 1116318887 14:43434239-43434261 CCCCCAAGCAAGACTTTTATCCT No data
Right 1116318895 14:43434285-43434307 ACATTGACTTGGCCTCCTTATGG No data
1116318888_1116318895 22 Left 1116318888 14:43434240-43434262 CCCCAAGCAAGACTTTTATCCTG No data
Right 1116318895 14:43434285-43434307 ACATTGACTTGGCCTCCTTATGG No data
1116318890_1116318895 20 Left 1116318890 14:43434242-43434264 CCAAGCAAGACTTTTATCCTGTT No data
Right 1116318895 14:43434285-43434307 ACATTGACTTGGCCTCCTTATGG No data
1116318892_1116318895 3 Left 1116318892 14:43434259-43434281 CCTGTTCTTAAAAGGCTTGAGAC No data
Right 1116318895 14:43434285-43434307 ACATTGACTTGGCCTCCTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116318895 Original CRISPR ACATTGACTTGGCCTCCTTA TGG Intergenic
No off target data available for this crispr