ID: 1116319737

View in Genome Browser
Species Human (GRCh38)
Location 14:43446368-43446390
Sequence CACCACCCTCTAGTAGGCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116319727_1116319737 -6 Left 1116319727 14:43446351-43446373 CCAACCCTCCTCCCACCCACCAC No data
Right 1116319737 14:43446368-43446390 CACCACCCTCTAGTAGGCCTGGG No data
1116319728_1116319737 -10 Left 1116319728 14:43446355-43446377 CCCTCCTCCCACCCACCACCCTC 0: 18
1: 654
2: 1912
3: 2830
4: 6058
Right 1116319737 14:43446368-43446390 CACCACCCTCTAGTAGGCCTGGG No data
1116319726_1116319737 -5 Left 1116319726 14:43446350-43446372 CCCAACCCTCCTCCCACCCACCA No data
Right 1116319737 14:43446368-43446390 CACCACCCTCTAGTAGGCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116319737 Original CRISPR CACCACCCTCTAGTAGGCCT GGG Intergenic
No off target data available for this crispr