ID: 1116326902

View in Genome Browser
Species Human (GRCh38)
Location 14:43541259-43541281
Sequence CAGCTCGGACAGCTTGGCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 215
Summary {0: 1, 1: 8, 2: 18, 3: 22, 4: 166}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116326895_1116326902 5 Left 1116326895 14:43541231-43541253 CCTGCTTGGCCCGCTGTAGGGCA 0: 1
1: 3
2: 12
3: 27
4: 101
Right 1116326902 14:43541259-43541281 CAGCTCGGACAGCTTGGCCTTGG 0: 1
1: 8
2: 18
3: 22
4: 166
1116326897_1116326902 -5 Left 1116326897 14:43541241-43541263 CCGCTGTAGGGCAGCCACCAGCT 0: 1
1: 0
2: 6
3: 37
4: 214
Right 1116326902 14:43541259-43541281 CAGCTCGGACAGCTTGGCCTTGG 0: 1
1: 8
2: 18
3: 22
4: 166
1116326890_1116326902 25 Left 1116326890 14:43541211-43541233 CCGCAGCTGCTGCTCCAAGTCCT 0: 1
1: 0
2: 6
3: 42
4: 630
Right 1116326902 14:43541259-43541281 CAGCTCGGACAGCTTGGCCTTGG 0: 1
1: 8
2: 18
3: 22
4: 166
1116326892_1116326902 11 Left 1116326892 14:43541225-43541247 CCAAGTCCTGCTTGGCCCGCTGT 0: 1
1: 0
2: 16
3: 24
4: 142
Right 1116326902 14:43541259-43541281 CAGCTCGGACAGCTTGGCCTTGG 0: 1
1: 8
2: 18
3: 22
4: 166
1116326896_1116326902 -4 Left 1116326896 14:43541240-43541262 CCCGCTGTAGGGCAGCCACCAGC 0: 1
1: 0
2: 6
3: 38
4: 219
Right 1116326902 14:43541259-43541281 CAGCTCGGACAGCTTGGCCTTGG 0: 1
1: 8
2: 18
3: 22
4: 166
1116326889_1116326902 26 Left 1116326889 14:43541210-43541232 CCCGCAGCTGCTGCTCCAAGTCC 0: 1
1: 0
2: 8
3: 55
4: 544
Right 1116326902 14:43541259-43541281 CAGCTCGGACAGCTTGGCCTTGG 0: 1
1: 8
2: 18
3: 22
4: 166

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116326902 Original CRISPR CAGCTCGGACAGCTTGGCCT TGG Intergenic
900513670 1:3071500-3071522 CAGCTGGGACCGCTTGTCCCAGG + Intronic
903153473 1:21429107-21429129 CAGCTGGGCCCGCTTGCCCTCGG - Intergenic
903242020 1:21989282-21989304 CAGCACTGCCAGCTGGGCCTTGG - Exonic
903245528 1:22012470-22012492 CAGCACTGCCAGCTGGGCCTTGG - Exonic
903281434 1:22252315-22252337 CAGCTCCGCCAGCCTGGCCCAGG - Intergenic
903325473 1:22566500-22566522 CAGCCCGGGCAGATAGGCCTAGG + Intronic
906223701 1:44103709-44103731 CAGCTCGGACAGCTTGGCGTTGG + Intergenic
909232283 1:73105878-73105900 CAGCTCGGACAGCTTGGTGTTGG - Intergenic
910052950 1:82997621-82997643 CAGCTGGGACAGTTTGACCAAGG - Intergenic
912746354 1:112248638-112248660 CAGCTCAGACAGTTCGGCCTGGG + Intergenic
913317011 1:117562029-117562051 CAGCTCTGTAAGCTAGGCCTTGG + Intergenic
914932817 1:151949895-151949917 CAGCTCTGCCAGCGTGGCGTTGG + Intergenic
915619812 1:157074298-157074320 CAGCTCGGACAACTTGGCGTTGG - Intergenic
920982432 1:210850628-210850650 CAGTTCTGCTAGCTTGGCCTTGG + Intronic
1063714539 10:8514070-8514092 CAGCTCAGACACCTTGGTGTTGG + Intergenic
1067148678 10:43711922-43711944 GGGCTCGGTCAGGTTGGCCTTGG + Intergenic
1067853519 10:49770092-49770114 GGGCTGGGACAGCTTGGCTTTGG + Intergenic
1069832174 10:71288061-71288083 GAGCTCTGAAACCTTGGCCTGGG - Intronic
1072379985 10:94858179-94858201 CAGCTGGGAAAGCTTGAACTGGG - Intergenic
1072717647 10:97762304-97762326 CAGCTCCCACAGCCTGGCGTGGG + Intergenic
1073589455 10:104742615-104742637 GACCTTGGACAGCTGGGCCTGGG + Intronic
1074352929 10:112755824-112755846 CAGCTAAGACAGGTTGGCCTAGG + Intronic
1074604070 10:114943037-114943059 TTGCTTGGACAGCTTGCCCTTGG + Intronic
1074762125 10:116675021-116675043 CAGCTGGGAGGGCTTGGCCGGGG + Exonic
1075336016 10:121609291-121609313 CAGCTAGGACTGCCGGGCCTTGG - Intergenic
1075438554 10:122462026-122462048 CAGCTGGCACAGGTTGGCGTAGG - Exonic
1076612276 10:131733786-131733808 CAGGACTGACAGCCTGGCCTGGG - Intergenic
1077047287 11:552176-552198 CAGCTCTGACTTCCTGGCCTTGG + Exonic
1077730330 11:4723118-4723140 CAGCTCGGACAGCTTGGAGTTGG + Intronic
1081776738 11:45680981-45681003 GAGGTCAGACAGTTTGGCCTTGG - Intergenic
1083152152 11:60798635-60798657 CAGCTAGAACTGCCTGGCCTGGG + Intronic
1084091691 11:66883028-66883050 GAGCCCGGACAGCTGAGCCTCGG - Intronic
1084263230 11:67991840-67991862 CAGCACCGCCAGCTTAGCCTGGG + Exonic
1084507259 11:69576035-69576057 CATCCAGGAGAGCTTGGCCTGGG - Intergenic
1084730093 11:71067203-71067225 CAGCTCGGACAGGTTCCCCGTGG + Intronic
1084810172 11:71607287-71607309 CAGCACCGCCAGCTTAGCCTGGG - Intergenic
1087814455 11:102643108-102643130 CAGCACTGCCAGCTTGACCTTGG - Intergenic
1088619916 11:111671337-111671359 CAGCTCCACCAGCTTGGCATTGG + Intronic
1089599225 11:119603238-119603260 CAGCTCCGACAGCTCGGCGTTGG + Intergenic
1090383947 11:126345752-126345774 CAGTGTGGACAGCGTGGCCTGGG + Intergenic
1096518728 12:52172332-52172354 CAGCTGGGCCAGCTTGGTCTTGG + Exonic
1096569957 12:52516771-52516793 CAGCTCGGCCAGCTTGTTCCTGG + Exonic
1096574868 12:52546420-52546442 CAGCTCGTCCAGCTTGGCCCGGG + Exonic
1096578273 12:52568303-52568325 CAGCTCATCCAGCTTGGCCTGGG + Exonic
1096581389 12:52587765-52587787 CAGCTCATCCAGCTTGGCCCGGG + Exonic
1096584440 12:52610749-52610771 CAGCTCATCCAGCTTGGCCCTGG + Exonic
1096587192 12:52630399-52630421 CACCTCAGCCAGCTTGTCCTGGG + Intergenic
1096603399 12:52746721-52746743 GAGCTCTGCCAACTTGGCCTGGG + Intergenic
1096626435 12:52898813-52898835 CAGCTCGGACAACTTGGCGTTGG + Exonic
1097615571 12:61880368-61880390 CAGCTCCAACAGCTTGGTGTTGG - Intronic
1098264703 12:68706675-68706697 CAGCTTGGACAGCTTGGTGTTGG - Intronic
1102035407 12:109768315-109768337 CAGCTTGGTCCGCTTGCCCTCGG - Exonic
1102749759 12:115282260-115282282 CAGCTCTGAGAGCAAGGCCTGGG + Intergenic
1103341918 12:120225274-120225296 CGGCTCAGACAGCCTGGCCCTGG + Intronic
1104420396 12:128630105-128630127 GAGCAGGGACAGCATGGCCTTGG + Intronic
1107556389 13:41519786-41519808 CATCTCCCACAGCCTGGCCTAGG + Intergenic
1113617469 13:111691251-111691273 CCCCTGGGACAGCTTGGCCAGGG + Intergenic
1113622999 13:111776511-111776533 CCCCTGGGACAGCTTGGCCAGGG + Intergenic
1113827090 13:113264209-113264231 CAGGGCGGACACCATGGCCTTGG - Intronic
1115812074 14:37120593-37120615 CAGATCTGACTGCTTTGCCTTGG + Intronic
1115951625 14:38728077-38728099 CAGCTCGGACAGCTTGGTGTTGG - Intergenic
1116326902 14:43541259-43541281 CAGCTCGGACAGCTTGGCCTTGG + Intergenic
1118765038 14:68903979-68904001 CATCTGGGACAGCAAGGCCTTGG + Intronic
1119400413 14:74358741-74358763 CTGCAAGAACAGCTTGGCCTGGG - Exonic
1123035719 14:105471121-105471143 CAGCTGGGCCAGCGAGGCCTTGG + Intergenic
1125841030 15:42801347-42801369 CAGCTCAGACAGCTTGGCATTGG + Intronic
1126097864 15:45101935-45101957 CACCTCGGCCAGCTGGGCCTTGG + Exonic
1126106168 15:45148304-45148326 CACCTCAGCCAGCTGGGCCTTGG - Exonic
1126467319 15:48972950-48972972 CAGCTCGGACAGCTTAGTCTTGG - Intergenic
1126877533 15:53060419-53060441 CAGTTCTGACCACTTGGCCTCGG + Intergenic
1128731554 15:70024903-70024925 CAGAGGGGTCAGCTTGGCCTGGG - Intergenic
1128842243 15:70859758-70859780 CAGCTCGGACAGCTTGGCGTTGG - Intronic
1129597927 15:76979384-76979406 CAGCTCGGACAACTTGGCATTGG + Intergenic
1129672732 15:77616160-77616182 CACCTCAGACAGCCTGGCATTGG + Intronic
1132026056 15:98405369-98405391 GAGCTCAGACAGGCTGGCCTTGG - Intergenic
1132478463 16:154035-154057 CAGCTCGCTCAGCTTGGACAGGG - Exonic
1132480548 16:164625-164647 CAGCTCGCTCAGCTTGGACAGGG - Intronic
1132761467 16:1510506-1510528 CAGCTGGGACACCCGGGCCTTGG - Exonic
1132881220 16:2162529-2162551 CAGCTCCGCCACTTTGGCCTGGG + Intronic
1132939704 16:2500648-2500670 CAGCCTGGACAGCTGGTCCTGGG + Intronic
1135605446 16:23820371-23820393 CAGCTAGGACTGCATGGTCTAGG - Intergenic
1136153592 16:28367878-28367900 CAGCCCGGACCGCATGGACTCGG + Intergenic
1136209495 16:28747389-28747411 CAGCCCGGACCGCATGGACTCGG - Intergenic
1139393169 16:66618896-66618918 CAGCTCTGAGCGCTTGGCCCTGG - Intronic
1139604646 16:68009470-68009492 CAGCTGGGACAGCTGGTGCTGGG - Intronic
1140753718 16:78048831-78048853 CAGCTTGGACAGCTTGGCGTTGG + Intronic
1141647413 16:85375158-85375180 CAGCTCGCACAGCCTGAGCTGGG - Intergenic
1144090731 17:11853998-11854020 CAGCTCTGTCAGGTTGGTCTGGG - Exonic
1144585182 17:16483351-16483373 CAGCACAGACAGGTTGGCCTCGG + Intronic
1147896559 17:43755357-43755379 CAGCTCGGCCTGGTTGGCTTTGG + Exonic
1151819794 17:76491291-76491313 CAGCTGGGATGGCCTGGCCTTGG - Intronic
1152586240 17:81190680-81190702 CAGCGTGGCCAGCTCGGCCTTGG + Exonic
1157063555 18:44321169-44321191 CAGCTCGGACAGCTTGGTGTTGG + Intergenic
1157292051 18:46416708-46416730 CAGCTGGGACAGATGGGTCTAGG + Intronic
1159589834 18:70321777-70321799 CAGGTAGGACAGGTTGGCATAGG + Intronic
1160891983 19:1383916-1383938 CAGCACCGCCATCTTGGCCTCGG - Exonic
1161125758 19:2556347-2556369 CAGCTCAGGAAGCTGGGCCTGGG - Intronic
1166795656 19:45423880-45423902 CAGCACGGCCAGCGTGGCCCAGG + Intronic
1167528552 19:50000687-50000709 CAGCTGGGAGAGCTCGGCCGGGG - Intronic
1167566822 19:50261955-50261977 GAGAGCGGACAGCTTGACCTGGG - Intronic
1167660161 19:50791699-50791721 CAGCCCGGCAAGGTTGGCCTGGG - Exonic
926561069 2:14418014-14418036 AAGGTGGGAAAGCTTGGCCTTGG + Intergenic
929888659 2:45901327-45901349 CAGGTCGGAGCGTTTGGCCTTGG - Intronic
931252878 2:60549683-60549705 CAGCTCGGCCAGCTCGGCCGCGG + Intronic
932224968 2:70032323-70032345 CTGCTCAGACACCTTGGCTTAGG + Intergenic
934755917 2:96824793-96824815 CAGCTCTGCCAGCTCTGCCTGGG + Intronic
935102083 2:100006653-100006675 GAACTTGGAGAGCTTGGCCTTGG + Exonic
936145210 2:109976118-109976140 CAGCCCGGAGAGCTTGCCCAAGG - Intergenic
936199475 2:110395360-110395382 CAGCCCGGAGAGCTTGCCCAAGG + Intergenic
938063356 2:128268570-128268592 CAGCTGGGCCCGCTTGCCCTCGG + Exonic
938758814 2:134405203-134405225 AAACTTGGACATCTTGGCCTGGG - Intronic
940690006 2:156904678-156904700 CAGGTTGGACAGCTTGGATTGGG + Intergenic
942558646 2:177198147-177198169 CAGCTCGGACAGCTTGGCGTTGG - Intergenic
943064431 2:183071424-183071446 CAGCTCAGACAGCTTGGCGCTGG + Intergenic
944763445 2:202840715-202840737 CAGCTCGGAGAGCTTGGCATTGG + Intronic
946320879 2:218953774-218953796 CAGCTCAGACAGCTTGGTGTTGG + Intergenic
948140820 2:235670627-235670649 CAGCTCCGGGAGCCTGGCCTGGG + Intronic
948891586 2:240909394-240909416 GAGCTCGGCCAGCTCTGCCTGGG + Intergenic
1169150932 20:3288791-3288813 CAGCTGGAACAGGTTGGCCCAGG - Intronic
1169190143 20:3653542-3653564 CAGCTTCGACTGCATGGCCTGGG + Intergenic
1169193460 20:3671618-3671640 CAGCTGGACCTGCTTGGCCTGGG - Exonic
1172351991 20:34250248-34250270 CAACTCTGACAGCCTGCCCTGGG - Intronic
1173864487 20:46305580-46305602 CAGCTGGCACTGCATGGCCTGGG - Intronic
1174417432 20:50376861-50376883 CTGCTGGGACACCATGGCCTGGG - Intergenic
1175440811 20:58989895-58989917 CAGCACGGACATCATGGCCTGGG - Exonic
1175869357 20:62200911-62200933 GAGCTGGGACAGATTGGCTTGGG - Exonic
1176150649 20:63589082-63589104 CAGCTTGGGCTGCTTGGCCACGG - Exonic
1178488880 21:33035406-33035428 CAGCTGGCAGAGCTTGGCCAAGG - Intergenic
1184452475 22:44591296-44591318 CAGCCCGGACTTCTAGGCCTGGG + Intergenic
950262607 3:11553695-11553717 GAGCTCAGATAGTTTGGCCTCGG + Intronic
950424754 3:12919125-12919147 CTGCTTGGACACCTGGGCCTGGG + Intronic
951685787 3:25342797-25342819 TAGGTAGCACAGCTTGGCCTGGG + Intronic
952327837 3:32336933-32336955 CAGCTATGACCCCTTGGCCTTGG - Intronic
952611544 3:35216086-35216108 CAGCTCGGACAGCTTGGCGTTGG + Intergenic
953863588 3:46565212-46565234 CCGCCCAGGCAGCTTGGCCTTGG - Intronic
955839480 3:63096756-63096778 CAGCTCGGACAGCTTGGCGTTGG + Intergenic
955980301 3:64518627-64518649 CAGCTCGATCAGCTTTACCTAGG - Intronic
957966175 3:87324309-87324331 CAGCTCATACAGCTTGGTGTTGG - Intergenic
961010114 3:123429945-123429967 CAGCGGGGGCAGCTCGGCCTGGG + Intronic
961235154 3:125359954-125359976 CAGCTGGCACAACTGGGCCTGGG + Intronic
962712816 3:138101865-138101887 CAGCTCGGACAGCTTGGCGTTGG + Intronic
964802249 3:160568869-160568891 CAGCTTGGAGAGCTTGGCATTGG - Intergenic
965605779 3:170496477-170496499 CAGCTCCGACCGCTTGGCGCTGG - Intronic
968626985 4:1630172-1630194 CAGCTCCGACAGCTTGGAAGGGG - Intronic
969617642 4:8262818-8262840 CAGCACCCACAGCTGGGCCTGGG + Intergenic
969732118 4:8963665-8963687 CAGCACCGCCAGCTTAGCCTGGG - Intergenic
969791713 4:9497750-9497772 CAGCACCGCCAGCTTAGCCTGGG - Intergenic
977928671 4:102729106-102729128 CAGCTTGGACAGCTTGGCGTTGG + Intronic
980234689 4:130090459-130090481 CAGAGCGGACAGCGAGGCCTAGG - Intergenic
984924861 4:184797744-184797766 CCGCTCGGACCCCTTGTCCTTGG - Intronic
987011833 5:13774207-13774229 CAGCAATGATAGCTTGGCCTAGG + Intronic
987118485 5:14744962-14744984 CAGAATGGGCAGCTTGGCCTTGG - Intronic
989523013 5:42423494-42423516 CAACTCGGAATGCTTGGCCCGGG + Intergenic
990900488 5:60743939-60743961 CAGCTCAGACAGCTTGGCGTTGG + Intergenic
993252742 5:85549817-85549839 CAGCTGGGCCAGGTCGGCCTTGG - Intergenic
994320802 5:98392461-98392483 CAGCTCGGACAGCTTGCGGTTGG + Intergenic
998887174 5:146706559-146706581 CAGCTCGGACAGCTTAGCGTTGG + Intronic
999205827 5:149847269-149847291 CTGCTGGGACATCTTGGCCATGG - Intronic
999453215 5:151694023-151694045 CAGTGTGGACAGCTAGGCCTGGG + Intergenic
1001924206 5:175624435-175624457 CTGCTGGGACAGTTTGGGCTGGG + Intergenic
1004425193 6:15502313-15502335 GAGCTCGGCCAGCTGGGCCCCGG - Intronic
1005315506 6:24599398-24599420 CAGCTTGGACAGCTTGGCATTGG - Intronic
1007733903 6:43968526-43968548 CAGCTTGGTCAGGCTGGCCTGGG - Intergenic
1012169608 6:96002219-96002241 GAGCTGTCACAGCTTGGCCTGGG - Intergenic
1012253720 6:97008521-97008543 CAGCTCAGAGAGTTTGGCATGGG - Intronic
1013519957 6:110923972-110923994 CAGCCAGGCCAGGTTGGCCTTGG - Intergenic
1014843880 6:126252211-126252233 GAGCTGGGACAGCTGGGACTTGG + Intergenic
1015496621 6:133889729-133889751 CAGCTTGGAGAGCTTGGTGTCGG - Exonic
1015539190 6:134297356-134297378 CAGCTCAGACAGCTTGGCGTTGG + Intronic
1018317263 6:162569322-162569344 CAGCTTGGACAGCTTGGTGTTGG - Intronic
1019573778 7:1726472-1726494 GAGCTGGGCCAGCTTGGCCTTGG - Intronic
1019743696 7:2688213-2688235 CAGCGTGGGCAGCTCGGCCTGGG - Intronic
1020236645 7:6361045-6361067 CAGCTGGGCCAGCAGGGCCTGGG - Intergenic
1020309168 7:6855780-6855802 CAGCACCGCCAGCTTAGCCTGGG + Intergenic
1022189116 7:27999798-27999820 CAGCTCAGACAGCTCTGCCTTGG + Intronic
1023289658 7:38656239-38656261 CAGCTCAGACAGCTTGGCTTTGG - Intergenic
1023908091 7:44536328-44536350 CTCCTCCCACAGCTTGGCCTGGG + Exonic
1025160784 7:56658921-56658943 CACCTCTGAGAGATTGGCCTGGG - Intergenic
1025253207 7:57365675-57365697 CTGCTGGGACACCATGGCCTGGG + Intergenic
1026765559 7:73157313-73157335 CAGCTGGGTCACCTGGGCCTGGG - Intergenic
1027042032 7:74967006-74967028 CAGCTGGGTCACCTGGGCCTGGG - Intronic
1027081609 7:75235348-75235370 CAGCTGGGTCACCTGGGCCTGGG + Intergenic
1027631555 7:80612010-80612032 CAGCACTCACTGCTTGGCCTTGG - Intronic
1029381372 7:100217344-100217366 CAGCTCGTCCAGCCTGGCCTGGG - Intronic
1029390194 7:100269929-100269951 CAGCTGGGTCACCTGGGCCTGGG + Intronic
1029400802 7:100344654-100344676 CAGCTTGTCCAGCCTGGCCTGGG - Intronic
1029453957 7:100657902-100657924 CAGCTCTGACAACTTGGGGTAGG + Intergenic
1033977166 7:147116513-147116535 CAGCTGGGACAACCTGCCCTGGG + Intronic
1034818653 7:154196777-154196799 CAGCCTGGGGAGCTTGGCCTCGG - Intronic
1041781144 8:61579265-61579287 CAGCTCGGACAACTTGGCGTTGG - Intronic
1042271541 8:66961502-66961524 CAGCTTGGACAGCTTGGTGTCGG + Exonic
1048870035 8:138789766-138789788 CAGCTCTGTCACCTTGGCCATGG + Intronic
1048982381 8:139709723-139709745 GAGCTCAGCCAGCCTGGCCTCGG - Intergenic
1049798343 8:144506532-144506554 CTGCTCGGTGAGCTTGGCCTTGG - Exonic
1052606881 9:30715366-30715388 CTGCTTGGGCAGCTTGGCATTGG + Intergenic
1054804467 9:69384569-69384591 CTGCTCGGGCAGCATGACCTGGG - Intronic
1056145462 9:83724372-83724394 CAACTCTGGCAGCTAGGCCTTGG - Intergenic
1057943653 9:99306205-99306227 CAGCTCGGACAGCTTGGCGTTGG - Intergenic
1060184759 9:121557619-121557641 CAGCCCCCAGAGCTTGGCCTTGG - Intergenic
1060864580 9:126985310-126985332 CAGCTCTGCCAGGTTGGCTTTGG - Intronic
1061189932 9:129076516-129076538 CAGCTCGGGCAGCCTCCCCTGGG + Intergenic
1061543378 9:131290105-131290127 CAGCTCGGGCAGAAAGGCCTCGG + Exonic
1062032389 9:134367582-134367604 CTGCACCGACAGCTTGGCCGAGG - Intronic
1062507022 9:136882749-136882771 AAGCTGTGACACCTTGGCCTGGG - Intronic
1187063889 X:15814252-15814274 CAGCCTGGTCAGCTTAGCCTTGG + Intronic
1187173296 X:16871225-16871247 CAGCTCCGCCAGCTTGGGGTGGG - Intergenic
1189478470 X:41375167-41375189 CAGCACAGTCAGCCTGGCCTGGG + Intergenic
1189893782 X:45632671-45632693 CAGCTCGGACAACTTGGCCTTGG + Intergenic
1191220765 X:57985727-57985749 CAGCTGGGAAAGCTTGGCATTGG - Intergenic
1192221077 X:69197735-69197757 CAGCTTGGGCTGCCTGGCCTGGG - Intergenic
1195470011 X:105220175-105220197 CACCTGGGGCAGCCTGGCCTTGG - Exonic
1195732659 X:107981905-107981927 CACCTGGGGCAGCCTGGCCTTGG - Exonic
1200684132 Y:6245042-6245064 CAGCGGGCACAGCTTGGCCCTGG - Intergenic
1201048503 Y:9909344-9909366 CAGCGGGCACAGCTTGGCCCTGG + Intergenic
1202115877 Y:21468425-21468447 CAGCGGGCACAGCTTGGCCCTGG + Intergenic