ID: 1116334237

View in Genome Browser
Species Human (GRCh38)
Location 14:43636811-43636833
Sequence CACTGGATATGGGCTTCCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116334232_1116334237 27 Left 1116334232 14:43636761-43636783 CCAATTTGAGATAATGAAGCTAT No data
Right 1116334237 14:43636811-43636833 CACTGGATATGGGCTTCCCCTGG No data
1116334231_1116334237 28 Left 1116334231 14:43636760-43636782 CCCAATTTGAGATAATGAAGCTA No data
Right 1116334237 14:43636811-43636833 CACTGGATATGGGCTTCCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116334237 Original CRISPR CACTGGATATGGGCTTCCCC TGG Intergenic
No off target data available for this crispr