ID: 1116334423

View in Genome Browser
Species Human (GRCh38)
Location 14:43639304-43639326
Sequence GCACCCTGGGTTCTTGCAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116334423_1116334431 10 Left 1116334423 14:43639304-43639326 CCCTTTGCAAGAACCCAGGGTGC No data
Right 1116334431 14:43639337-43639359 TGTGATGCAGACATGAGCACAGG No data
1116334423_1116334432 21 Left 1116334423 14:43639304-43639326 CCCTTTGCAAGAACCCAGGGTGC No data
Right 1116334432 14:43639348-43639370 CATGAGCACAGGAGCTGCCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116334423 Original CRISPR GCACCCTGGGTTCTTGCAAA GGG (reversed) Intergenic
No off target data available for this crispr