ID: 1116336902

View in Genome Browser
Species Human (GRCh38)
Location 14:43667759-43667781
Sequence GTGGTACACACTTGTAATCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116336895_1116336902 29 Left 1116336895 14:43667707-43667729 CCAACATGGTGAGACCTCATCTC 0: 50
1: 3879
2: 49817
3: 105447
4: 133330
Right 1116336902 14:43667759-43667781 GTGGTACACACTTGTAATCCTGG No data
1116336896_1116336902 15 Left 1116336896 14:43667721-43667743 CCTCATCTCTACTGAAATACAAA 0: 64
1: 2824
2: 6201
3: 10825
4: 27980
Right 1116336902 14:43667759-43667781 GTGGTACACACTTGTAATCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116336902 Original CRISPR GTGGTACACACTTGTAATCC TGG Intergenic
No off target data available for this crispr