ID: 1116336961

View in Genome Browser
Species Human (GRCh38)
Location 14:43668487-43668509
Sequence AGGTGCATATAGTATAAGAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116336961_1116336965 29 Left 1116336961 14:43668487-43668509 CCTATCTTATACTATATGCACCT No data
Right 1116336965 14:43668539-43668561 AGTTCTTAGAGATGTTCAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116336961 Original CRISPR AGGTGCATATAGTATAAGAT AGG (reversed) Intergenic
No off target data available for this crispr