ID: 1116352895

View in Genome Browser
Species Human (GRCh38)
Location 14:43888137-43888159
Sequence ACCATAAATGTCTTCAGACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116352893_1116352895 -3 Left 1116352893 14:43888117-43888139 CCCTTCTCATAGTTGTAATAACC No data
Right 1116352895 14:43888137-43888159 ACCATAAATGTCTTCAGACATGG No data
1116352891_1116352895 4 Left 1116352891 14:43888110-43888132 CCCAGCTCCCTTCTCATAGTTGT No data
Right 1116352895 14:43888137-43888159 ACCATAAATGTCTTCAGACATGG No data
1116352894_1116352895 -4 Left 1116352894 14:43888118-43888140 CCTTCTCATAGTTGTAATAACCA No data
Right 1116352895 14:43888137-43888159 ACCATAAATGTCTTCAGACATGG No data
1116352890_1116352895 23 Left 1116352890 14:43888091-43888113 CCACTAAATGACAGCAGCTCCCA No data
Right 1116352895 14:43888137-43888159 ACCATAAATGTCTTCAGACATGG No data
1116352892_1116352895 3 Left 1116352892 14:43888111-43888133 CCAGCTCCCTTCTCATAGTTGTA No data
Right 1116352895 14:43888137-43888159 ACCATAAATGTCTTCAGACATGG No data
1116352889_1116352895 30 Left 1116352889 14:43888084-43888106 CCTCTATCCACTAAATGACAGCA No data
Right 1116352895 14:43888137-43888159 ACCATAAATGTCTTCAGACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116352895 Original CRISPR ACCATAAATGTCTTCAGACA TGG Intergenic
No off target data available for this crispr