ID: 1116354694

View in Genome Browser
Species Human (GRCh38)
Location 14:43913968-43913990
Sequence CTCTCCCCATGACATGTGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116354694_1116354698 -1 Left 1116354694 14:43913968-43913990 CCAGCCACATGTCATGGGGAGAG No data
Right 1116354698 14:43913990-43914012 GAATCTTTGTGCTTGAGGAAGGG No data
1116354694_1116354700 18 Left 1116354694 14:43913968-43913990 CCAGCCACATGTCATGGGGAGAG No data
Right 1116354700 14:43914009-43914031 AGGGACAGCACAGTGATTGTGGG No data
1116354694_1116354696 -6 Left 1116354694 14:43913968-43913990 CCAGCCACATGTCATGGGGAGAG No data
Right 1116354696 14:43913985-43914007 GGAGAGAATCTTTGTGCTTGAGG No data
1116354694_1116354699 17 Left 1116354694 14:43913968-43913990 CCAGCCACATGTCATGGGGAGAG No data
Right 1116354699 14:43914008-43914030 AAGGGACAGCACAGTGATTGTGG No data
1116354694_1116354701 30 Left 1116354694 14:43913968-43913990 CCAGCCACATGTCATGGGGAGAG No data
Right 1116354701 14:43914021-43914043 GTGATTGTGGGACTTTGCACTGG 0: 9
1: 67
2: 140
3: 170
4: 293
1116354694_1116354697 -2 Left 1116354694 14:43913968-43913990 CCAGCCACATGTCATGGGGAGAG No data
Right 1116354697 14:43913989-43914011 AGAATCTTTGTGCTTGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116354694 Original CRISPR CTCTCCCCATGACATGTGGC TGG (reversed) Intergenic
No off target data available for this crispr