ID: 1116354696

View in Genome Browser
Species Human (GRCh38)
Location 14:43913985-43914007
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116354694_1116354696 -6 Left 1116354694 14:43913968-43913990 CCAGCCACATGTCATGGGGAGAG No data
Right 1116354696 14:43913985-43914007 GGAGAGAATCTTTGTGCTTGAGG No data
1116354686_1116354696 13 Left 1116354686 14:43913949-43913971 CCTGCCCCATCCTCTGGCACCAG No data
Right 1116354696 14:43913985-43914007 GGAGAGAATCTTTGTGCTTGAGG No data
1116354685_1116354696 18 Left 1116354685 14:43913944-43913966 CCACTCCTGCCCCATCCTCTGGC No data
Right 1116354696 14:43913985-43914007 GGAGAGAATCTTTGTGCTTGAGG No data
1116354690_1116354696 3 Left 1116354690 14:43913959-43913981 CCTCTGGCACCAGCCACATGTCA No data
Right 1116354696 14:43913985-43914007 GGAGAGAATCTTTGTGCTTGAGG No data
1116354689_1116354696 7 Left 1116354689 14:43913955-43913977 CCATCCTCTGGCACCAGCCACAT No data
Right 1116354696 14:43913985-43914007 GGAGAGAATCTTTGTGCTTGAGG No data
1116354683_1116354696 24 Left 1116354683 14:43913938-43913960 CCTATACCACTCCTGCCCCATCC No data
Right 1116354696 14:43913985-43914007 GGAGAGAATCTTTGTGCTTGAGG No data
1116354695_1116354696 -10 Left 1116354695 14:43913972-43913994 CCACATGTCATGGGGAGAGAATC No data
Right 1116354696 14:43913985-43914007 GGAGAGAATCTTTGTGCTTGAGG No data
1116354687_1116354696 9 Left 1116354687 14:43913953-43913975 CCCCATCCTCTGGCACCAGCCAC No data
Right 1116354696 14:43913985-43914007 GGAGAGAATCTTTGTGCTTGAGG No data
1116354688_1116354696 8 Left 1116354688 14:43913954-43913976 CCCATCCTCTGGCACCAGCCACA No data
Right 1116354696 14:43913985-43914007 GGAGAGAATCTTTGTGCTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116354696 Original CRISPR GGAGAGAATCTTTGTGCTTG AGG Intergenic
No off target data available for this crispr