ID: 1116354699

View in Genome Browser
Species Human (GRCh38)
Location 14:43914008-43914030
Sequence AAGGGACAGCACAGTGATTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116354690_1116354699 26 Left 1116354690 14:43913959-43913981 CCTCTGGCACCAGCCACATGTCA No data
Right 1116354699 14:43914008-43914030 AAGGGACAGCACAGTGATTGTGG No data
1116354695_1116354699 13 Left 1116354695 14:43913972-43913994 CCACATGTCATGGGGAGAGAATC No data
Right 1116354699 14:43914008-43914030 AAGGGACAGCACAGTGATTGTGG No data
1116354694_1116354699 17 Left 1116354694 14:43913968-43913990 CCAGCCACATGTCATGGGGAGAG No data
Right 1116354699 14:43914008-43914030 AAGGGACAGCACAGTGATTGTGG No data
1116354689_1116354699 30 Left 1116354689 14:43913955-43913977 CCATCCTCTGGCACCAGCCACAT No data
Right 1116354699 14:43914008-43914030 AAGGGACAGCACAGTGATTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116354699 Original CRISPR AAGGGACAGCACAGTGATTG TGG Intergenic
No off target data available for this crispr