ID: 1116354700

View in Genome Browser
Species Human (GRCh38)
Location 14:43914009-43914031
Sequence AGGGACAGCACAGTGATTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116354694_1116354700 18 Left 1116354694 14:43913968-43913990 CCAGCCACATGTCATGGGGAGAG No data
Right 1116354700 14:43914009-43914031 AGGGACAGCACAGTGATTGTGGG No data
1116354690_1116354700 27 Left 1116354690 14:43913959-43913981 CCTCTGGCACCAGCCACATGTCA No data
Right 1116354700 14:43914009-43914031 AGGGACAGCACAGTGATTGTGGG No data
1116354695_1116354700 14 Left 1116354695 14:43913972-43913994 CCACATGTCATGGGGAGAGAATC No data
Right 1116354700 14:43914009-43914031 AGGGACAGCACAGTGATTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116354700 Original CRISPR AGGGACAGCACAGTGATTGT GGG Intergenic
No off target data available for this crispr